| Variant ID: vg0428508285 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 28508285 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CTCTCCCGTGCACCGAGTCACTGACTCGTGGGCCCGCCCCAGGACCCCGCACGATGGATCCGGGTCTCCCTCTCTCTCTCCCCGCCTCCCTCTGTTGGAC[C/T]
GCCTACTTAGGCCGCGTCGGCCCAATTAATTGGCCGAGCCGCGCCAACTCCTCTCGGGCCGCGCTCAAGCCGCCCGCGAAGTCTACATCTCCTCCCTATC
GATAGGGAGGAGATGTAGACTTCGCGGGCGGCTTGAGCGCGGCCCGAGAGGAGTTGGCGCGGCTCGGCCAATTAATTGGGCCGACGCGGCCTAAGTAGGC[G/A]
GTCCAACAGAGGGAGGCGGGGAGAGAGAGAGGGAGACCCGGATCCATCGTGCGGGGTCCTGGGGCGGGCCCACGAGTCAGTGACTCGGTGCACGGGAGAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.60% | 1.90% | 0.49% | 0.00% | NA |
| All Indica | 2759 | 98.70% | 1.20% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 95.40% | 3.20% | 1.39% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.50% | 3.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.50% | 0.30% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 93.10% | 4.30% | 2.61% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 94.20% | 5.40% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0428508285 | C -> T | LOC_Os04g47940.1 | upstream_gene_variant ; 988.0bp to feature; MODIFIER | silent_mutation | Average:53.402; most accessible tissue: Zhenshan97 panicle, score: 69.946 | N | N | N | N |
| vg0428508285 | C -> T | LOC_Os04g47940-LOC_Os04g47950 | intergenic_region ; MODIFIER | silent_mutation | Average:53.402; most accessible tissue: Zhenshan97 panicle, score: 69.946 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0428508285 | NA | 1.95E-10 | Awn_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0428508285 | NA | 6.76E-06 | mr1382 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428508285 | NA | 1.94E-06 | mr1038_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428508285 | NA | 5.28E-07 | mr1057_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0428508285 | 2.39E-06 | 2.39E-06 | mr1681_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |