Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0428312965:

Variant ID: vg0428312965 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 28312965
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.07, others allele: 0.00, population size: 177. )

Flanking Sequence (100 bp) in Reference Genome:

GCCGAAGTTCACTTAGGTTCTTCGGAGGCCTTGTCAAGACGGTGTAAAGAGACATGAGGATAGGTTTCAACGCTAGGTGTCGTCTGGGTAAGGGATCATC[A/G]
GAAGAACGCCACTCGCGAAGTTCATGGCCGCATCTCACTACGCGTATCAGGTACTCAAGATGCCCGGGTCGAAGGGAACAATCACTATCTAAGGGAACGC

Reverse complement sequence

GCGTTCCCTTAGATAGTGATTGTTCCCTTCGACCCGGGCATCTTGAGTACCTGATACGCGTAGTGAGATGCGGCCATGAACTTCGCGAGTGGCGTTCTTC[T/C]
GATGATCCCTTACCCAGACGACACCTAGCGTTGAAACCTATCCTCATGTCTCTTTACACCGTCTTGACAAGGCCTCCGAAGAACCTAAGTGAACTTCGGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.70%	40.80%	0.06%	0.47%	NA
All Indica	2759	93.70%	5.50%	0.07%	0.72%	NA
All Japonica	1512	0.60%	99.40%	0.00%	0.00%	NA
Aus	269	55.00%	45.00%	0.00%	0.00%	NA
Indica I	595	95.10%	3.40%	0.00%	1.51%	NA
Indica II	465	94.80%	4.50%	0.22%	0.43%	NA
Indica III	913	94.00%	5.80%	0.00%	0.22%	NA
Indica Intermediate	786	91.60%	7.40%	0.13%	0.89%	NA
Temperate Japonica	767	0.40%	99.60%	0.00%	0.00%	NA
Tropical Japonica	504	1.00%	99.00%	0.00%	0.00%	NA
Japonica Intermediate	241	0.40%	99.60%	0.00%	0.00%	NA
VI/Aromatic	96	0.00%	100.00%	0.00%	0.00%	NA
Intermediate	90	36.70%	60.00%	1.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0428312965	A -> DEL	N	N	silent_mutation	Average:55.279; most accessible tissue: Minghui63 young leaf, score: 73.49	N	N	N	N
vg0428312965	A -> G	LOC_Os04g47720.1	upstream_gene_variant ; 2102.0bp to feature; MODIFIER	silent_mutation	Average:55.279; most accessible tissue: Minghui63 young leaf, score: 73.49	N	N	N	N
vg0428312965	A -> G	LOC_Os04g47710.1	downstream_gene_variant ; 527.0bp to feature; MODIFIER	silent_mutation	Average:55.279; most accessible tissue: Minghui63 young leaf, score: 73.49	N	N	N	N
vg0428312965	A -> G	LOC_Os04g47710-LOC_Os04g47720	intergenic_region ; MODIFIER	silent_mutation	Average:55.279; most accessible tissue: Minghui63 young leaf, score: 73.49	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0428312965	NA	1.31E-27	mr1145	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428312965	3.83E-06	7.24E-09	mr1145	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428312965	NA	2.05E-21	mr1416	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428312965	NA	3.18E-06	mr1560	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428312965	NA	3.86E-06	mr1620	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428312965	NA	5.61E-10	mr1663	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428312965	NA	4.78E-35	mr1181_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428312965	NA	9.80E-06	mr1329_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428312965	NA	5.07E-08	mr1690_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428312965	NA	6.71E-24	mr1708_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251