\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0428312965:

Variant ID: vg0428312965 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 28312965
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.07, others allele: 0.00, population size: 177. )

Flanking Sequence (100 bp) in Reference Genome:


GCCGAAGTTCACTTAGGTTCTTCGGAGGCCTTGTCAAGACGGTGTAAAGAGACATGAGGATAGGTTTCAACGCTAGGTGTCGTCTGGGTAAGGGATCATC[A/G]
GAAGAACGCCACTCGCGAAGTTCATGGCCGCATCTCACTACGCGTATCAGGTACTCAAGATGCCCGGGTCGAAGGGAACAATCACTATCTAAGGGAACGC

Reverse complement sequence

GCGTTCCCTTAGATAGTGATTGTTCCCTTCGACCCGGGCATCTTGAGTACCTGATACGCGTAGTGAGATGCGGCCATGAACTTCGCGAGTGGCGTTCTTC[T/C]
GATGATCCCTTACCCAGACGACACCTAGCGTTGAAACCTATCCTCATGTCTCTTTACACCGTCTTGACAAGGCCTCCGAAGAACCTAAGTGAACTTCGGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.70% 40.80% 0.06% 0.47% NA
All Indica  2759 93.70% 5.50% 0.07% 0.72% NA
All Japonica  1512 0.60% 99.40% 0.00% 0.00% NA
Aus  269 55.00% 45.00% 0.00% 0.00% NA
Indica I  595 95.10% 3.40% 0.00% 1.51% NA
Indica II  465 94.80% 4.50% 0.22% 0.43% NA
Indica III  913 94.00% 5.80% 0.00% 0.22% NA
Indica Intermediate  786 91.60% 7.40% 0.13% 0.89% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 1.00% 99.00% 0.00% 0.00% NA
Japonica Intermediate  241 0.40% 99.60% 0.00% 0.00% NA
VI/Aromatic  96 0.00% 100.00% 0.00% 0.00% NA
Intermediate  90 36.70% 60.00% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0428312965 A -> DEL N N silent_mutation Average:55.279; most accessible tissue: Minghui63 young leaf, score: 73.49 N N N N
vg0428312965 A -> G LOC_Os04g47720.1 upstream_gene_variant ; 2102.0bp to feature; MODIFIER silent_mutation Average:55.279; most accessible tissue: Minghui63 young leaf, score: 73.49 N N N N
vg0428312965 A -> G LOC_Os04g47710.1 downstream_gene_variant ; 527.0bp to feature; MODIFIER silent_mutation Average:55.279; most accessible tissue: Minghui63 young leaf, score: 73.49 N N N N
vg0428312965 A -> G LOC_Os04g47710-LOC_Os04g47720 intergenic_region ; MODIFIER silent_mutation Average:55.279; most accessible tissue: Minghui63 young leaf, score: 73.49 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0428312965 NA 1.31E-27 mr1145 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428312965 3.83E-06 7.24E-09 mr1145 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428312965 NA 2.05E-21 mr1416 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428312965 NA 3.18E-06 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428312965 NA 3.86E-06 mr1620 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428312965 NA 5.61E-10 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428312965 NA 4.78E-35 mr1181_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428312965 NA 9.80E-06 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428312965 NA 5.07E-08 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428312965 NA 6.71E-24 mr1708_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251