\
| Variant ID: vg0427858791 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 27858791 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 113. )
TAAAGAGCTAAAATTCAAGTTTTTCTTAAAGAACTAGTTTACATATTGCTTGTTATTGACGGTGACTATTTGATCTCCTTTACTATCAATATTAGTTATT[T/C]
GGTCTCACGGTTTATCTTTATCCCACACCCCCTAATCTCAAATCCTGGCTTCGCCCCTGATCCTACCTTACTTCTCACTCACACAAATAAGCATTGTGGG
CCCACAATGCTTATTTGTGTGAGTGAGAAGTAAGGTAGGATCAGGGGCGAAGCCAGGATTTGAGATTAGGGGGTGTGGGATAAAGATAAACCGTGAGACC[A/G]
AATAACTAATATTGATAGTAAAGGAGATCAAATAGTCACCGTCAATAACAAGCAATATGTAAACTAGTTCTTTAAGAAAAACTTGAATTTTAGCTCTTTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.70% | 48.10% | 0.28% | 0.00% | NA |
| All Indica | 2759 | 81.40% | 18.20% | 0.36% | 0.00% | NA |
| All Japonica | 1512 | 0.50% | 99.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 58.40% | 40.90% | 0.74% | 0.00% | NA |
| Indica I | 595 | 80.70% | 19.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 91.80% | 7.70% | 0.43% | 0.00% | NA |
| Indica III | 913 | 78.00% | 21.70% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 79.80% | 19.70% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 0.30% | 99.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.60% | 99.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 34.40% | 64.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0427858791 | T -> C | LOC_Os04g46990.1 | upstream_gene_variant ; 3828.0bp to feature; MODIFIER | silent_mutation | Average:43.716; most accessible tissue: Callus, score: 64.19 | N | N | N | N |
| vg0427858791 | T -> C | LOC_Os04g47000.1 | downstream_gene_variant ; 271.0bp to feature; MODIFIER | silent_mutation | Average:43.716; most accessible tissue: Callus, score: 64.19 | N | N | N | N |
| vg0427858791 | T -> C | LOC_Os04g46990-LOC_Os04g47000 | intergenic_region ; MODIFIER | silent_mutation | Average:43.716; most accessible tissue: Callus, score: 64.19 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0427858791 | 6.88E-07 | 1.01E-39 | mr1873 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427858791 | 1.13E-06 | 2.91E-07 | mr1873 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427858791 | NA | 9.34E-16 | mr1579_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427858791 | 8.27E-08 | 4.04E-39 | mr1873_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0427858791 | 7.71E-07 | 1.26E-08 | mr1873_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |