Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0427084460:

Variant ID: vg0427084460 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 27084460
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 350. )

Flanking Sequence (100 bp) in Reference Genome:

TAAGTCGGAAAGGGTGGTCGAGCTGGAAAAGACTATTTGCCATGAAAAAGACCCATGGTGGTGGAAAAGACCCTCGGTCGAGGAGAAGACCTATGGTGGT[G/A]
GAAAAGACTCTTGATCATGAAGAAGGCAATTTGGACAACAAAGATGCCAAGAGAATATTCCCAAGGACCACTCAACCACTTCATCCAGCTGGCACCAAAA

Reverse complement sequence

TTTTGGTGCCAGCTGGATGAAGTGGTTGAGTGGTCCTTGGGAATATTCTCTTGGCATCTTTGTTGTCCAAATTGCCTTCTTCATGATCAAGAGTCTTTTC[C/T]
ACCACCATAGGTCTTCTCCTCGACCGAGGGTCTTTTCCACCACCATGGGTCTTTTTCATGGCAAATAGTCTTTTCCAGCTCGACCACCCTTTCCGACTTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.60%	11.50%	0.89%	0.00%	NA
All Indica	2759	98.30%	1.40%	0.33%	0.00%	NA
All Japonica	1512	66.70%	31.60%	1.72%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.80%	0.70%	0.50%	0.00%	NA
Indica II	465	97.40%	2.40%	0.22%	0.00%	NA
Indica III	913	98.60%	1.30%	0.11%	0.00%	NA
Indica Intermediate	786	98.10%	1.40%	0.51%	0.00%	NA
Temperate Japonica	767	96.30%	3.40%	0.26%	0.00%	NA
Tropical Japonica	504	18.30%	78.20%	3.57%	0.00%	NA
Japonica Intermediate	241	73.40%	24.10%	2.49%	0.00%	NA
VI/Aromatic	96	87.50%	11.50%	1.04%	0.00%	NA
Intermediate	90	76.70%	16.70%	6.67%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0427084460	G -> A	LOC_Os04g45750.1	upstream_gene_variant ; 3865.0bp to feature; MODIFIER	silent_mutation	Average:53.035; most accessible tissue: Zhenshan97 root, score: 76.749	N	N	N	N
vg0427084460	G -> A	LOC_Os04g45760.1	upstream_gene_variant ; 581.0bp to feature; MODIFIER	silent_mutation	Average:53.035; most accessible tissue: Zhenshan97 root, score: 76.749	N	N	N	N
vg0427084460	G -> A	LOC_Os04g45770.1	upstream_gene_variant ; 3424.0bp to feature; MODIFIER	silent_mutation	Average:53.035; most accessible tissue: Zhenshan97 root, score: 76.749	N	N	N	N
vg0427084460	G -> A	LOC_Os04g45750.2	upstream_gene_variant ; 3865.0bp to feature; MODIFIER	silent_mutation	Average:53.035; most accessible tissue: Zhenshan97 root, score: 76.749	N	N	N	N
vg0427084460	G -> A	LOC_Os04g45750-LOC_Os04g45760	intergenic_region ; MODIFIER	silent_mutation	Average:53.035; most accessible tissue: Zhenshan97 root, score: 76.749	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0427084460	NA	2.88E-11	mr1235	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084460	NA	1.04E-07	mr1243	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084460	NA	9.29E-30	mr1301	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084460	NA	2.26E-14	mr1301	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084460	NA	1.88E-21	mr1410	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084460	NA	2.63E-11	mr1410	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084460	NA	1.96E-20	mr1518	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084460	NA	2.11E-06	mr1518	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084460	NA	2.22E-23	mr1676	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084460	NA	3.45E-07	mr1676	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084460	NA	9.56E-32	mr1699	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084460	NA	1.60E-17	mr1699	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084460	NA	2.27E-09	mr1993	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084460	NA	3.00E-30	mr1301_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084460	NA	3.17E-15	mr1301_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084460	NA	7.50E-22	mr1410_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084460	NA	2.46E-06	mr1498_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084460	NA	8.25E-22	mr1676_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084460	NA	3.12E-07	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084460	NA	7.34E-32	mr1699_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084460	NA	5.53E-18	mr1699_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084460	NA	1.45E-13	mr1864_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084460	NA	4.68E-18	mr1993_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084460	NA	5.64E-15	mr1993_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251