\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0427084460:

Variant ID: vg0427084460 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 27084460
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 350. )

Flanking Sequence (100 bp) in Reference Genome:


TAAGTCGGAAAGGGTGGTCGAGCTGGAAAAGACTATTTGCCATGAAAAAGACCCATGGTGGTGGAAAAGACCCTCGGTCGAGGAGAAGACCTATGGTGGT[G/A]
GAAAAGACTCTTGATCATGAAGAAGGCAATTTGGACAACAAAGATGCCAAGAGAATATTCCCAAGGACCACTCAACCACTTCATCCAGCTGGCACCAAAA

Reverse complement sequence

TTTTGGTGCCAGCTGGATGAAGTGGTTGAGTGGTCCTTGGGAATATTCTCTTGGCATCTTTGTTGTCCAAATTGCCTTCTTCATGATCAAGAGTCTTTTC[C/T]
ACCACCATAGGTCTTCTCCTCGACCGAGGGTCTTTTCCACCACCATGGGTCTTTTTCATGGCAAATAGTCTTTTCCAGCTCGACCACCCTTTCCGACTTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.60% 11.50% 0.89% 0.00% NA
All Indica  2759 98.30% 1.40% 0.33% 0.00% NA
All Japonica  1512 66.70% 31.60% 1.72% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.80% 0.70% 0.50% 0.00% NA
Indica II  465 97.40% 2.40% 0.22% 0.00% NA
Indica III  913 98.60% 1.30% 0.11% 0.00% NA
Indica Intermediate  786 98.10% 1.40% 0.51% 0.00% NA
Temperate Japonica  767 96.30% 3.40% 0.26% 0.00% NA
Tropical Japonica  504 18.30% 78.20% 3.57% 0.00% NA
Japonica Intermediate  241 73.40% 24.10% 2.49% 0.00% NA
VI/Aromatic  96 87.50% 11.50% 1.04% 0.00% NA
Intermediate  90 76.70% 16.70% 6.67% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0427084460 G -> A LOC_Os04g45750.1 upstream_gene_variant ; 3865.0bp to feature; MODIFIER silent_mutation Average:53.035; most accessible tissue: Zhenshan97 root, score: 76.749 N N N N
vg0427084460 G -> A LOC_Os04g45760.1 upstream_gene_variant ; 581.0bp to feature; MODIFIER silent_mutation Average:53.035; most accessible tissue: Zhenshan97 root, score: 76.749 N N N N
vg0427084460 G -> A LOC_Os04g45770.1 upstream_gene_variant ; 3424.0bp to feature; MODIFIER silent_mutation Average:53.035; most accessible tissue: Zhenshan97 root, score: 76.749 N N N N
vg0427084460 G -> A LOC_Os04g45750.2 upstream_gene_variant ; 3865.0bp to feature; MODIFIER silent_mutation Average:53.035; most accessible tissue: Zhenshan97 root, score: 76.749 N N N N
vg0427084460 G -> A LOC_Os04g45750-LOC_Os04g45760 intergenic_region ; MODIFIER silent_mutation Average:53.035; most accessible tissue: Zhenshan97 root, score: 76.749 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0427084460 NA 2.88E-11 mr1235 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084460 NA 1.04E-07 mr1243 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084460 NA 9.29E-30 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084460 NA 2.26E-14 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084460 NA 1.88E-21 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084460 NA 2.63E-11 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084460 NA 1.96E-20 mr1518 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084460 NA 2.11E-06 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084460 NA 2.22E-23 mr1676 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084460 NA 3.45E-07 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084460 NA 9.56E-32 mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084460 NA 1.60E-17 mr1699 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084460 NA 2.27E-09 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084460 NA 3.00E-30 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084460 NA 3.17E-15 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084460 NA 7.50E-22 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084460 NA 2.46E-06 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084460 NA 8.25E-22 mr1676_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084460 NA 3.12E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084460 NA 7.34E-32 mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084460 NA 5.53E-18 mr1699_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084460 NA 1.45E-13 mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084460 NA 4.68E-18 mr1993_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427084460 NA 5.64E-15 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251