\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0426972613:

Variant ID: vg0426972613 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 26972613
Reference Allele: GAlternative Allele: C,T
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:


GCATTGGCAGGTGGAGTATATACCGTACCCTCCCCCCCTTTTTTTCCTTTCTTCTTCTTTTTTCCATTTATATATATAATGGATATATTTTTTAAATAAT[G/C,T]
ATAATTTTACAAACAAAGAATCTACCATCATATAACTTAAGCCGGTGTACTTTTTACTCTGTACTATTATTTTCAAATAATGCACTATTTTAAAATAAAT

Reverse complement sequence

ATTTATTTTAAAATAGTGCATTATTTGAAAATAATAGTACAGAGTAAAAAGTACACCGGCTTAAGTTATATGATGGTAGATTCTTTGTTTGTAAAATTAT[C/G,A]
ATTATTTAAAAAATATATCCATTATATATATAAATGGAAAAAAGAAGAAGAAAGGAAAAAAAGGGGGGGAGGGTACGGTATATACTCCACCTGCCAATGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.00% 8.60% 16.57% 8.78% T: 0.02%
All Indica  2759 42.70% 14.40% 28.05% 14.79% NA
All Japonica  1512 99.80% 0.00% 0.07% 0.13% NA
Aus  269 99.30% 0.40% 0.00% 0.00% T: 0.37%
Indica I  595 33.90% 9.10% 28.91% 28.07% NA
Indica II  465 25.40% 18.50% 35.05% 21.08% NA
Indica III  913 56.10% 15.00% 24.21% 4.71% NA
Indica Intermediate  786 44.10% 15.40% 27.74% 12.72% NA
Temperate Japonica  767 99.90% 0.00% 0.00% 0.13% NA
Tropical Japonica  504 99.80% 0.00% 0.00% 0.20% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 77.80% 7.80% 8.89% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0426972613 G -> C LOC_Os04g45580.1 upstream_gene_variant ; 4531.0bp to feature; MODIFIER silent_mutation Average:8.834; most accessible tissue: Minghui63 flower, score: 13.501 N N N N
vg0426972613 G -> C LOC_Os04g45590.1 upstream_gene_variant ; 2986.0bp to feature; MODIFIER silent_mutation Average:8.834; most accessible tissue: Minghui63 flower, score: 13.501 N N N N
vg0426972613 G -> C LOC_Os04g45600.1 upstream_gene_variant ; 4792.0bp to feature; MODIFIER silent_mutation Average:8.834; most accessible tissue: Minghui63 flower, score: 13.501 N N N N
vg0426972613 G -> C LOC_Os04g45580-LOC_Os04g45590 intergenic_region ; MODIFIER silent_mutation Average:8.834; most accessible tissue: Minghui63 flower, score: 13.501 N N N N
vg0426972613 G -> DEL N N silent_mutation Average:8.834; most accessible tissue: Minghui63 flower, score: 13.501 N N N N
vg0426972613 G -> T LOC_Os04g45580.1 upstream_gene_variant ; 4531.0bp to feature; MODIFIER silent_mutation Average:8.834; most accessible tissue: Minghui63 flower, score: 13.501 N N N N
vg0426972613 G -> T LOC_Os04g45590.1 upstream_gene_variant ; 2986.0bp to feature; MODIFIER silent_mutation Average:8.834; most accessible tissue: Minghui63 flower, score: 13.501 N N N N
vg0426972613 G -> T LOC_Os04g45600.1 upstream_gene_variant ; 4792.0bp to feature; MODIFIER silent_mutation Average:8.834; most accessible tissue: Minghui63 flower, score: 13.501 N N N N
vg0426972613 G -> T LOC_Os04g45580-LOC_Os04g45590 intergenic_region ; MODIFIER silent_mutation Average:8.834; most accessible tissue: Minghui63 flower, score: 13.501 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0426972613 NA 3.07E-06 Spikelet_length Ind_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0426972613 NA 9.65E-08 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251