\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0425422291:

Variant ID: vg0425422291 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 25422291
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


CGACCCGATGATCGCGCCCACCTTCCCCGACGCCGCCGATATCCCGTGGCTCGTCGCATGCAGCCTCGCCGGGTATATCTCCGCCGGCACGATGAACGTC[G/A]
CGAGCTTCGCACCACGTCGTCGTTGTCGTTGTCATCATCGAGGTTGAGAAGCCGCTGCAGGAAGAGGAGTGGTCGGACGACGGTGAGTTCATCGAGCTGG

Reverse complement sequence

CCAGCTCGATGAACTCACCGTCGTCCGACCACTCCTCTTCCTGCAGCGGCTTCTCAACCTCGATGATGACAACGACAACGACGACGTGGTGCGAAGCTCG[C/T]
GACGTTCATCGTGCCGGCGGAGATATACCCGGCGAGGCTGCATGCGACGAGCCACGGGATATCGGCGGCGTCGGGGAAGGTGGGCGCGATCATCGGGTCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.00% 45.20% 1.74% 0.11% NA
All Indica  2759 83.90% 14.20% 1.78% 0.14% NA
All Japonica  1512 4.00% 94.60% 1.39% 0.07% NA
Aus  269 5.60% 92.90% 1.49% 0.00% NA
Indica I  595 82.70% 13.10% 4.20% 0.00% NA
Indica II  465 95.10% 3.40% 1.29% 0.22% NA
Indica III  913 85.30% 14.60% 0.11% 0.00% NA
Indica Intermediate  786 76.60% 20.90% 2.16% 0.38% NA
Temperate Japonica  767 0.30% 98.00% 1.69% 0.00% NA
Tropical Japonica  504 7.50% 91.70% 0.79% 0.00% NA
Japonica Intermediate  241 8.30% 89.60% 1.66% 0.41% NA
VI/Aromatic  96 81.20% 18.80% 0.00% 0.00% NA
Intermediate  90 41.10% 50.00% 8.89% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0425422291 G -> DEL N N silent_mutation Average:62.012; most accessible tissue: Minghui63 root, score: 77.29 N N N N
vg0425422291 G -> A LOC_Os04g42960.1 downstream_gene_variant ; 3558.0bp to feature; MODIFIER silent_mutation Average:62.012; most accessible tissue: Minghui63 root, score: 77.29 N N N N
vg0425422291 G -> A LOC_Os04g42970.1 downstream_gene_variant ; 1375.0bp to feature; MODIFIER silent_mutation Average:62.012; most accessible tissue: Minghui63 root, score: 77.29 N N N N
vg0425422291 G -> A LOC_Os04g42980.1 downstream_gene_variant ; 1658.0bp to feature; MODIFIER silent_mutation Average:62.012; most accessible tissue: Minghui63 root, score: 77.29 N N N N
vg0425422291 G -> A LOC_Os04g42980.2 downstream_gene_variant ; 1658.0bp to feature; MODIFIER silent_mutation Average:62.012; most accessible tissue: Minghui63 root, score: 77.29 N N N N
vg0425422291 G -> A LOC_Os04g42970-LOC_Os04g42980 intergenic_region ; MODIFIER silent_mutation Average:62.012; most accessible tissue: Minghui63 root, score: 77.29 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0425422291 NA 1.03E-09 mr1260 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425422291 1.47E-06 1.47E-06 mr1260 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425422291 NA 1.27E-07 mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425422291 NA 4.89E-09 mr1335_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251