\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0424926413:

Variant ID: vg0424926413 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 24926413
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACCACAGGTGCACCACAAGCTAGCTTGTTTGGTCATATTCATAGCAGGTGATGTTACAATGGGAGAGGAATTGAGGAAGGTTACTTGGTTTGGTTTGCCT[G/A]
GATAAGGGGAAAATAGGTCAGTCCTTATTTACCAGTATATAGTAATAGTTATATATATGTATGTCATACCATTCCCGTATAACTATTTTCTCTATACGAT

Reverse complement sequence

ATCGTATAGAGAAAATAGTTATACGGGAATGGTATGACATACATATATATAACTATTACTATATACTGGTAAATAAGGACTGACCTATTTTCCCCTTATC[C/T]
AGGCAAACCAAACCAAGTAACCTTCCTCAATTCCTCTCCCATTGTAACATCACCTGCTATGAATATGACCAAACAAGCTAGCTTGTGGTGCACCTGTGGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.90% 0.10% 6.16% 49.87% NA
All Indica  2759 10.20% 0.10% 5.84% 83.80% NA
All Japonica  1512 99.10% 0.00% 0.13% 0.73% NA
Aus  269 52.40% 0.00% 44.98% 2.60% NA
Indica I  595 15.30% 0.00% 0.67% 84.03% NA
Indica II  465 4.90% 0.20% 1.08% 93.76% NA
Indica III  913 4.10% 0.20% 11.28% 84.45% NA
Indica Intermediate  786 16.70% 0.10% 6.23% 76.97% NA
Temperate Japonica  767 99.70% 0.00% 0.00% 0.26% NA
Tropical Japonica  504 98.00% 0.00% 0.40% 1.59% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 97.90% 0.00% 2.08% 0.00% NA
Intermediate  90 64.40% 0.00% 5.56% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0424926413 G -> DEL N N silent_mutation Average:12.381; most accessible tissue: Callus, score: 34.37 N N N N
vg0424926413 G -> A LOC_Os04g42100.1 upstream_gene_variant ; 1759.0bp to feature; MODIFIER silent_mutation Average:12.381; most accessible tissue: Callus, score: 34.37 N N N N
vg0424926413 G -> A LOC_Os04g42100-LOC_Os04g42110 intergenic_region ; MODIFIER silent_mutation Average:12.381; most accessible tissue: Callus, score: 34.37 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0424926413 NA 5.20E-10 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424926413 NA 1.93E-07 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424926413 NA 8.81E-08 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424926413 3.26E-06 3.91E-09 mr1329_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424926413 1.88E-06 2.38E-07 mr1337_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424926413 NA 7.97E-11 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424926413 NA 6.53E-06 mr1373_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424926413 NA 2.19E-06 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424926413 NA 8.16E-06 mr1522_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424926413 3.94E-06 4.38E-09 mr1524_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424926413 NA 9.09E-16 mr1578_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424926413 NA 3.37E-06 mr1648_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424926413 NA 7.34E-09 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424926413 NA 9.93E-06 mr1683_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424926413 NA 6.75E-09 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424926413 NA 3.09E-06 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424926413 NA 1.18E-06 mr1812_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424926413 3.90E-06 3.90E-06 mr1812_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424926413 NA 4.15E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424926413 7.66E-06 7.66E-06 mr1832_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424926413 4.72E-06 NA mr1843_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424926413 NA 1.40E-06 mr1982_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251