Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0424926413:

Variant ID: vg0424926413 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 24926413
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACCACAGGTGCACCACAAGCTAGCTTGTTTGGTCATATTCATAGCAGGTGATGTTACAATGGGAGAGGAATTGAGGAAGGTTACTTGGTTTGGTTTGCCT[G/A]
GATAAGGGGAAAATAGGTCAGTCCTTATTTACCAGTATATAGTAATAGTTATATATATGTATGTCATACCATTCCCGTATAACTATTTTCTCTATACGAT

Reverse complement sequence

ATCGTATAGAGAAAATAGTTATACGGGAATGGTATGACATACATATATATAACTATTACTATATACTGGTAAATAAGGACTGACCTATTTTCCCCTTATC[C/T]
AGGCAAACCAAACCAAGTAACCTTCCTCAATTCCTCTCCCATTGTAACATCACCTGCTATGAATATGACCAAACAAGCTAGCTTGTGGTGCACCTGTGGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	43.90%	0.10%	6.16%	49.87%	NA
All Indica	2759	10.20%	0.10%	5.84%	83.80%	NA
All Japonica	1512	99.10%	0.00%	0.13%	0.73%	NA
Aus	269	52.40%	0.00%	44.98%	2.60%	NA
Indica I	595	15.30%	0.00%	0.67%	84.03%	NA
Indica II	465	4.90%	0.20%	1.08%	93.76%	NA
Indica III	913	4.10%	0.20%	11.28%	84.45%	NA
Indica Intermediate	786	16.70%	0.10%	6.23%	76.97%	NA
Temperate Japonica	767	99.70%	0.00%	0.00%	0.26%	NA
Tropical Japonica	504	98.00%	0.00%	0.40%	1.59%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	97.90%	0.00%	2.08%	0.00%	NA
Intermediate	90	64.40%	0.00%	5.56%	30.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0424926413	G -> DEL	N	N	silent_mutation	Average:12.381; most accessible tissue: Callus, score: 34.37	N	N	N	N
vg0424926413	G -> A	LOC_Os04g42100.1	upstream_gene_variant ; 1759.0bp to feature; MODIFIER	silent_mutation	Average:12.381; most accessible tissue: Callus, score: 34.37	N	N	N	N
vg0424926413	G -> A	LOC_Os04g42100-LOC_Os04g42110	intergenic_region ; MODIFIER	silent_mutation	Average:12.381; most accessible tissue: Callus, score: 34.37	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0424926413	NA	5.20E-10	mr1011_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424926413	NA	1.93E-07	mr1184_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424926413	NA	8.81E-08	mr1278_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424926413	3.26E-06	3.91E-09	mr1329_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424926413	1.88E-06	2.38E-07	mr1337_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424926413	NA	7.97E-11	mr1338_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424926413	NA	6.53E-06	mr1373_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424926413	NA	2.19E-06	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424926413	NA	8.16E-06	mr1522_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424926413	3.94E-06	4.38E-09	mr1524_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424926413	NA	9.09E-16	mr1578_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424926413	NA	3.37E-06	mr1648_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424926413	NA	7.34E-09	mr1683_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424926413	NA	9.93E-06	mr1683_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424926413	NA	6.75E-09	mr1690_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424926413	NA	3.09E-06	mr1754_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424926413	NA	1.18E-06	mr1812_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424926413	3.90E-06	3.90E-06	mr1812_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424926413	NA	4.15E-07	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424926413	7.66E-06	7.66E-06	mr1832_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424926413	4.72E-06	NA	mr1843_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424926413	NA	1.40E-06	mr1982_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251