Variant ID: vg0423711696 (JBrowse) | Variation Type: SNP |
Chromosome: chr04 | Position: 23711696 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 213. )
TAAATTATTTATCTGATCATACCGTTGTGTTAATTATAACTAAATCTTTATAATAGGATATCACATGATTATATTCTGATAAGACAAAACATATGTTTCC[G/A]
TCCGATAACACTCAATGTTTTATATGCGATAGCATTATGTTTCAACGTGTATCTTTGTTGTGTTTCACATAATTTTTAAATGTTTCATTAGCTGATTTTT
AAAAATCAGCTAATGAAACATTTAAAAATTATGTGAAACACAACAAAGATACACGTTGAAACATAATGCTATCGCATATAAAACATTGAGTGTTATCGGA[C/T]
GGAAACATATGTTTTGTCTTATCAGAATATAATCATGTGATATCCTATTATAAAGATTTAGTTATAATTAACACAACGGTATGATCAGATAAATAATTTA
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 97.10% | 2.70% | 0.21% | 0.00% | NA |
All Indica | 2759 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 92.70% | 6.70% | 0.60% | 0.00% | NA |
Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
Tropical Japonica | 504 | 80.20% | 18.50% | 1.39% | 0.00% | NA |
Japonica Intermediate | 241 | 95.90% | 3.70% | 0.41% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0423711696 | G -> A | LOC_Os04g39780.1 | upstream_gene_variant ; 4348.0bp to feature; MODIFIER | silent_mutation | Average:27.324; most accessible tissue: Callus, score: 67.209 | N | N | N | N |
vg0423711696 | G -> A | LOC_Os04g39800.1 | upstream_gene_variant ; 1273.0bp to feature; MODIFIER | silent_mutation | Average:27.324; most accessible tissue: Callus, score: 67.209 | N | N | N | N |
vg0423711696 | G -> A | LOC_Os04g39814.1 | downstream_gene_variant ; 3750.0bp to feature; MODIFIER | silent_mutation | Average:27.324; most accessible tissue: Callus, score: 67.209 | N | N | N | N |
vg0423711696 | G -> A | LOC_Os04g39814.2 | downstream_gene_variant ; 3747.0bp to feature; MODIFIER | silent_mutation | Average:27.324; most accessible tissue: Callus, score: 67.209 | N | N | N | N |
vg0423711696 | G -> A | LOC_Os04g39814.3 | downstream_gene_variant ; 3747.0bp to feature; MODIFIER | silent_mutation | Average:27.324; most accessible tissue: Callus, score: 67.209 | N | N | N | N |
vg0423711696 | G -> A | LOC_Os04g39800-LOC_Os04g39814 | intergenic_region ; MODIFIER | silent_mutation | Average:27.324; most accessible tissue: Callus, score: 67.209 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0423711696 | NA | 2.76E-12 | Grain_width | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
vg0423711696 | 2.43E-06 | 2.43E-06 | mr1384 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0423711696 | NA | 3.62E-07 | mr1830 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0423711696 | NA | 2.54E-06 | mr1077_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |