\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0423675516:

Variant ID: vg0423675516 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 23675516
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTGCGAGCTGGTAGCAAGAAGCTATCTCTATCATCAAAACCCGCCTGTTCTTGGCGGTGACTAGAGGTATAAAAAGAGGGGGAAGAACGACCATAGGGTC[A/G]
TGCTCCAACCCTAGGACGCGCCCCTAATGGGCCCAACTTGGATACACAGCCCATTGGGCCAAAAGAGGTGACGCAGCACCATCGACAGAAAATAGTCGGG

Reverse complement sequence

CCCGACTATTTTCTGTCGATGGTGCTGCGTCACCTCTTTTGGCCCAATGGGCTGTGTATCCAAGTTGGGCCCATTAGGGGCGCGTCCTAGGGTTGGAGCA[T/C]
GACCCTATGGTCGTTCTTCCCCCTCTTTTTATACCTCTAGTCACCGCCAAGAACAGGCGGGTTTTGATGATAGAGATAGCTTCTTGCTACCAGCTCGCAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 31.50% 12.70% 4.93% 50.83% NA
All Indica  2759 9.10% 3.60% 5.07% 82.24% NA
All Japonica  1512 63.00% 31.40% 5.29% 0.26% NA
Aus  269 58.40% 1.50% 1.49% 38.66% NA
Indica I  595 17.60% 7.10% 7.90% 67.39% NA
Indica II  465 4.70% 2.20% 3.44% 89.68% NA
Indica III  913 3.80% 2.30% 4.27% 89.59% NA
Indica Intermediate  786 11.50% 3.20% 4.83% 80.53% NA
Temperate Japonica  767 38.10% 52.90% 8.60% 0.39% NA
Tropical Japonica  504 94.60% 3.80% 1.39% 0.20% NA
Japonica Intermediate  241 76.30% 20.70% 2.90% 0.00% NA
VI/Aromatic  96 84.40% 12.50% 1.04% 2.08% NA
Intermediate  90 51.10% 14.40% 8.89% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0423675516 A -> DEL N N silent_mutation Average:6.572; most accessible tissue: Zhenshan97 flower, score: 11.396 N N N N
vg0423675516 A -> G LOC_Os04g39720.1 downstream_gene_variant ; 1690.0bp to feature; MODIFIER silent_mutation Average:6.572; most accessible tissue: Zhenshan97 flower, score: 11.396 N N N N
vg0423675516 A -> G LOC_Os04g39730.1 intron_variant ; MODIFIER silent_mutation Average:6.572; most accessible tissue: Zhenshan97 flower, score: 11.396 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0423675516 NA 1.12E-09 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0423675516 NA 7.17E-08 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423675516 NA 3.44E-09 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423675516 NA 4.81E-07 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423675516 NA 3.03E-08 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423675516 NA 5.88E-12 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423675516 NA 4.59E-06 mr1829 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423675516 NA 3.73E-06 mr1045_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423675516 NA 8.66E-06 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423675516 NA 4.03E-08 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423675516 NA 5.30E-06 mr1078_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423675516 NA 6.87E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423675516 NA 8.45E-06 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423675516 NA 2.59E-06 mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423675516 7.34E-07 7.34E-07 mr1568_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423675516 NA 2.70E-07 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423675516 NA 5.82E-07 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423675516 NA 9.18E-06 mr1638_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423675516 NA 5.37E-06 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423675516 NA 1.46E-06 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251