\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0423365056:

Variant ID: vg0423365056 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 23365056
Reference Allele: TCACAAlternative Allele: TCA,TCACACACA,ACACA,TCACACACACA,TCACACA,T
Primary Allele: TCACASecondary Allele: ACACA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGTACAGTGGCCTTCTCTCCTTCATCTGCCAGAGCCACAAATTTCCAGAAATTCACATCCGAGAGTAGCGTACACTGGCTCTCTCTCTCTCTCTCTCTC[TCACA/TCA,TCACACACA,ACACA,TCACACACACA,TCACACA,T]
CACACACACTGTCACACATTGTTTGCTCCTCGGAGAGTAGGAAAAAAAAAAGCATGAACCGTGCCTGTGAAACCTCGGCTTCCTTGTCCCACACGATCCT

Reverse complement sequence

AGGATCGTGTGGGACAAGGAAGCCGAGGTTTCACAGGCACGGTTCATGCTTTTTTTTTTCCTACTCTCCGAGGAGCAAACAATGTGTGACAGTGTGTGTG[TGTGA/TGA,TGTGTGTGA,TGTGT,TGTGTGTGTGA,TGTGTGA,A]
GAGAGAGAGAGAGAGAGAGAGCCAGTGTACGCTACTCTCGGATGTGAATTTCTGGAAATTTGTGGCTCTGGCAGATGAAGGAGAGAAGGCCACTGTACAT

Allele Frequencies:

Populations Population SizeFrequency of TCACA(primary allele) Frequency of ACACA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.90% 9.80% 2.29% 0.00% TCACACACA: 3.77%; TCA: 2.92%; TCACACA: 0.25%; T: 0.06%; TCACACACACA: 0.04%
All Indica  2759 82.80% 5.40% 2.17% 0.00% TCACACACA: 6.23%; TCA: 3.08%; TCACACA: 0.11%; T: 0.11%; TCACACACACA: 0.07%
All Japonica  1512 78.80% 16.90% 2.25% 0.00% TCA: 1.65%; TCACACA: 0.46%
Aus  269 83.60% 7.10% 2.60% 0.00% TCA: 6.69%
Indica I  595 93.30% 0.00% 2.69% 0.00% TCA: 2.35%; TCACACACA: 1.68%
Indica II  465 85.40% 2.40% 0.22% 0.00% TCACACACA: 7.96%; TCA: 4.09%
Indica III  913 76.50% 10.80% 2.63% 0.00% TCACACACA: 7.78%; TCA: 1.64%; T: 0.33%; TCACACA: 0.22%; TCACACACACA: 0.11%
Indica Intermediate  786 80.70% 5.10% 2.42% 0.00% TCACACACA: 6.87%; TCA: 4.71%; TCACACA: 0.13%; TCACACACACA: 0.13%
Temperate Japonica  767 95.00% 1.60% 1.17% 0.00% TCA: 1.83%; TCACACA: 0.39%
Tropical Japonica  504 51.00% 43.50% 3.57% 0.00% TCA: 1.19%; TCACACA: 0.79%
Japonica Intermediate  241 85.10% 10.00% 2.90% 0.00% TCA: 2.07%
VI/Aromatic  96 70.80% 16.70% 6.25% 0.00% TCA: 5.21%; TCACACA: 1.04%
Intermediate  90 62.20% 23.30% 1.11% 0.00% TCACACACA: 6.67%; TCA: 5.56%; TCACACA: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0423365056 TCACA -> TCA LOC_Os04g39260.3 upstream_gene_variant ; 3224.0bp to feature; MODIFIER silent_mutation Average:84.078; most accessible tissue: Minghui63 flag leaf, score: 94.503 N N N N
vg0423365056 TCACA -> TCA LOC_Os04g39260.1 upstream_gene_variant ; 3224.0bp to feature; MODIFIER silent_mutation Average:84.078; most accessible tissue: Minghui63 flag leaf, score: 94.503 N N N N
vg0423365056 TCACA -> TCA LOC_Os04g39260.2 upstream_gene_variant ; 3240.0bp to feature; MODIFIER silent_mutation Average:84.078; most accessible tissue: Minghui63 flag leaf, score: 94.503 N N N N
vg0423365056 TCACA -> TCA LOC_Os04g39280.1 downstream_gene_variant ; 2187.0bp to feature; MODIFIER silent_mutation Average:84.078; most accessible tissue: Minghui63 flag leaf, score: 94.503 N N N N
vg0423365056 TCACA -> TCA LOC_Os04g39280.2 downstream_gene_variant ; 2117.0bp to feature; MODIFIER silent_mutation Average:84.078; most accessible tissue: Minghui63 flag leaf, score: 94.503 N N N N
vg0423365056 TCACA -> TCA LOC_Os04g39270.1 intron_variant ; MODIFIER silent_mutation Average:84.078; most accessible tissue: Minghui63 flag leaf, score: 94.503 N N N N
vg0423365056 TCACA -> TCACACACACA LOC_Os04g39260.3 upstream_gene_variant ; 3226.0bp to feature; MODIFIER silent_mutation Average:84.078; most accessible tissue: Minghui63 flag leaf, score: 94.503 N N N N
vg0423365056 TCACA -> TCACACACACA LOC_Os04g39260.1 upstream_gene_variant ; 3226.0bp to feature; MODIFIER silent_mutation Average:84.078; most accessible tissue: Minghui63 flag leaf, score: 94.503 N N N N
vg0423365056 TCACA -> TCACACACACA LOC_Os04g39260.2 upstream_gene_variant ; 3242.0bp to feature; MODIFIER silent_mutation Average:84.078; most accessible tissue: Minghui63 flag leaf, score: 94.503 N N N N
vg0423365056 TCACA -> TCACACACACA LOC_Os04g39280.1 downstream_gene_variant ; 2185.0bp to feature; MODIFIER silent_mutation Average:84.078; most accessible tissue: Minghui63 flag leaf, score: 94.503 N N N N
vg0423365056 TCACA -> TCACACACACA LOC_Os04g39280.2 downstream_gene_variant ; 2115.0bp to feature; MODIFIER silent_mutation Average:84.078; most accessible tissue: Minghui63 flag leaf, score: 94.503 N N N N
vg0423365056 TCACA -> TCACACACACA LOC_Os04g39270.1 intron_variant ; MODIFIER silent_mutation Average:84.078; most accessible tissue: Minghui63 flag leaf, score: 94.503 N N N N
vg0423365056 TCACA -> T LOC_Os04g39260.3 upstream_gene_variant ; 3222.0bp to feature; MODIFIER silent_mutation Average:84.078; most accessible tissue: Minghui63 flag leaf, score: 94.503 N N N N
vg0423365056 TCACA -> T LOC_Os04g39260.1 upstream_gene_variant ; 3222.0bp to feature; MODIFIER silent_mutation Average:84.078; most accessible tissue: Minghui63 flag leaf, score: 94.503 N N N N
vg0423365056 TCACA -> T LOC_Os04g39260.2 upstream_gene_variant ; 3238.0bp to feature; MODIFIER silent_mutation Average:84.078; most accessible tissue: Minghui63 flag leaf, score: 94.503 N N N N
vg0423365056 TCACA -> T LOC_Os04g39280.1 downstream_gene_variant ; 2189.0bp to feature; MODIFIER silent_mutation Average:84.078; most accessible tissue: Minghui63 flag leaf, score: 94.503 N N N N
vg0423365056 TCACA -> T LOC_Os04g39280.2 downstream_gene_variant ; 2119.0bp to feature; MODIFIER silent_mutation Average:84.078; most accessible tissue: Minghui63 flag leaf, score: 94.503 N N N N
vg0423365056 TCACA -> T LOC_Os04g39270.1 intron_variant ; MODIFIER silent_mutation Average:84.078; most accessible tissue: Minghui63 flag leaf, score: 94.503 N N N N
vg0423365056 TCACA -> TCACACA LOC_Os04g39260.3 upstream_gene_variant ; 3226.0bp to feature; MODIFIER silent_mutation Average:84.078; most accessible tissue: Minghui63 flag leaf, score: 94.503 N N N N
vg0423365056 TCACA -> TCACACA LOC_Os04g39260.1 upstream_gene_variant ; 3226.0bp to feature; MODIFIER silent_mutation Average:84.078; most accessible tissue: Minghui63 flag leaf, score: 94.503 N N N N
vg0423365056 TCACA -> TCACACA LOC_Os04g39260.2 upstream_gene_variant ; 3242.0bp to feature; MODIFIER silent_mutation Average:84.078; most accessible tissue: Minghui63 flag leaf, score: 94.503 N N N N
vg0423365056 TCACA -> TCACACA LOC_Os04g39280.1 downstream_gene_variant ; 2185.0bp to feature; MODIFIER silent_mutation Average:84.078; most accessible tissue: Minghui63 flag leaf, score: 94.503 N N N N
vg0423365056 TCACA -> TCACACA LOC_Os04g39280.2 downstream_gene_variant ; 2115.0bp to feature; MODIFIER silent_mutation Average:84.078; most accessible tissue: Minghui63 flag leaf, score: 94.503 N N N N
vg0423365056 TCACA -> TCACACA LOC_Os04g39270.1 intron_variant ; MODIFIER silent_mutation Average:84.078; most accessible tissue: Minghui63 flag leaf, score: 94.503 N N N N
vg0423365056 TCACA -> ACACA LOC_Os04g39260.3 upstream_gene_variant ; 3221.0bp to feature; MODIFIER silent_mutation Average:84.078; most accessible tissue: Minghui63 flag leaf, score: 94.503 N N N N
vg0423365056 TCACA -> ACACA LOC_Os04g39260.1 upstream_gene_variant ; 3221.0bp to feature; MODIFIER silent_mutation Average:84.078; most accessible tissue: Minghui63 flag leaf, score: 94.503 N N N N
vg0423365056 TCACA -> ACACA LOC_Os04g39260.2 upstream_gene_variant ; 3237.0bp to feature; MODIFIER silent_mutation Average:84.078; most accessible tissue: Minghui63 flag leaf, score: 94.503 N N N N
vg0423365056 TCACA -> ACACA LOC_Os04g39280.1 downstream_gene_variant ; 2190.0bp to feature; MODIFIER silent_mutation Average:84.078; most accessible tissue: Minghui63 flag leaf, score: 94.503 N N N N
vg0423365056 TCACA -> ACACA LOC_Os04g39280.2 downstream_gene_variant ; 2120.0bp to feature; MODIFIER silent_mutation Average:84.078; most accessible tissue: Minghui63 flag leaf, score: 94.503 N N N N
vg0423365056 TCACA -> ACACA LOC_Os04g39270.1 intron_variant ; MODIFIER silent_mutation Average:84.078; most accessible tissue: Minghui63 flag leaf, score: 94.503 N N N N
vg0423365056 TCACA -> TCACACACA LOC_Os04g39260.3 upstream_gene_variant ; 3226.0bp to feature; MODIFIER silent_mutation Average:84.078; most accessible tissue: Minghui63 flag leaf, score: 94.503 N N N N
vg0423365056 TCACA -> TCACACACA LOC_Os04g39260.1 upstream_gene_variant ; 3226.0bp to feature; MODIFIER silent_mutation Average:84.078; most accessible tissue: Minghui63 flag leaf, score: 94.503 N N N N
vg0423365056 TCACA -> TCACACACA LOC_Os04g39260.2 upstream_gene_variant ; 3242.0bp to feature; MODIFIER silent_mutation Average:84.078; most accessible tissue: Minghui63 flag leaf, score: 94.503 N N N N
vg0423365056 TCACA -> TCACACACA LOC_Os04g39280.1 downstream_gene_variant ; 2185.0bp to feature; MODIFIER silent_mutation Average:84.078; most accessible tissue: Minghui63 flag leaf, score: 94.503 N N N N
vg0423365056 TCACA -> TCACACACA LOC_Os04g39280.2 downstream_gene_variant ; 2115.0bp to feature; MODIFIER silent_mutation Average:84.078; most accessible tissue: Minghui63 flag leaf, score: 94.503 N N N N
vg0423365056 TCACA -> TCACACACA LOC_Os04g39270.1 intron_variant ; MODIFIER silent_mutation Average:84.078; most accessible tissue: Minghui63 flag leaf, score: 94.503 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0423365056 TCACA ACACA 0.0 0.0 0.01 0.0 0.0 0.0
vg0423365056 TCACA T 0.14 0.14 0.08 0.06 0.1 0.07
vg0423365056 TCACA TCA 0.01 0.01 0.01 -0.04 0.01 0.0
vg0423365056 TCACA TCACA* -0.14 -0.21 -0.22 -0.01 -0.1 -0.13

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0423365056 8.58E-06 NA mr1086 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423365056 2.03E-06 5.61E-08 mr1096 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423365056 6.85E-06 3.12E-07 mr1155 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423365056 NA 4.06E-07 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423365056 NA 1.02E-06 mr1246 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423365056 NA 2.12E-06 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423365056 NA 2.54E-08 mr1248 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423365056 NA 7.43E-06 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423365056 NA 9.71E-06 mr1620 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423365056 2.80E-06 1.67E-11 mr1769 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423365056 3.11E-06 NA mr1949 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423365056 NA 7.64E-06 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251