\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0422820213:

Variant ID: vg0422820213 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 22820213
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAACTAACTAAAATTTGGAATAAATATAATAAAATTAAAAGTAGAGTTTAGAGTATGTATAAAAATACAATTTACAAATAACTAAAATTCGAAATTCGA[A/G]
ATTAAGAATAACATGGGAAGAAGAGTTTAAGGTCAATATAGGAATACAAATATAGAAATACAATTTAGAAGTAACTGAAATTCGAAATTAAAATTAAAGA

Reverse complement sequence

TCTTTAATTTTAATTTCGAATTTCAGTTACTTCTAAATTGTATTTCTATATTTGTATTCCTATATTGACCTTAAACTCTTCTTCCCATGTTATTCTTAAT[T/C]
TCGAATTTCGAATTTTAGTTATTTGTAAATTGTATTTTTATACATACTCTAAACTCTACTTTTAATTTTATTATATTTATTCCAAATTTTAGTTAGTTTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.90% 2.90% 2.24% 0.00% NA
All Indica  2759 98.90% 0.40% 0.69% 0.00% NA
All Japonica  1512 88.00% 6.80% 5.16% 0.00% NA
Aus  269 95.90% 3.70% 0.37% 0.00% NA
Indica I  595 98.20% 0.00% 1.85% 0.00% NA
Indica II  465 99.60% 0.00% 0.43% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 98.30% 0.90% 0.76% 0.00% NA
Temperate Japonica  767 84.10% 11.10% 4.82% 0.00% NA
Tropical Japonica  504 92.90% 2.00% 5.16% 0.00% NA
Japonica Intermediate  241 90.50% 3.30% 6.22% 0.00% NA
VI/Aromatic  96 84.40% 11.50% 4.17% 0.00% NA
Intermediate  90 92.20% 3.30% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0422820213 A -> G LOC_Os04g38360.1 upstream_gene_variant ; 817.0bp to feature; MODIFIER silent_mutation Average:16.875; most accessible tissue: Zhenshan97 flower, score: 24.143 N N N N
vg0422820213 A -> G LOC_Os04g38370.1 upstream_gene_variant ; 2055.0bp to feature; MODIFIER silent_mutation Average:16.875; most accessible tissue: Zhenshan97 flower, score: 24.143 N N N N
vg0422820213 A -> G LOC_Os04g38350-LOC_Os04g38360 intergenic_region ; MODIFIER silent_mutation Average:16.875; most accessible tissue: Zhenshan97 flower, score: 24.143 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0422820213 4.31E-06 NA mr1403_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422820213 NA 3.86E-06 mr1403_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251