\
| Variant ID: vg0422820213 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 22820213 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AAAACTAACTAAAATTTGGAATAAATATAATAAAATTAAAAGTAGAGTTTAGAGTATGTATAAAAATACAATTTACAAATAACTAAAATTCGAAATTCGA[A/G]
ATTAAGAATAACATGGGAAGAAGAGTTTAAGGTCAATATAGGAATACAAATATAGAAATACAATTTAGAAGTAACTGAAATTCGAAATTAAAATTAAAGA
TCTTTAATTTTAATTTCGAATTTCAGTTACTTCTAAATTGTATTTCTATATTTGTATTCCTATATTGACCTTAAACTCTTCTTCCCATGTTATTCTTAAT[T/C]
TCGAATTTCGAATTTTAGTTATTTGTAAATTGTATTTTTATACATACTCTAAACTCTACTTTTAATTTTATTATATTTATTCCAAATTTTAGTTAGTTTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.90% | 2.90% | 2.24% | 0.00% | NA |
| All Indica | 2759 | 98.90% | 0.40% | 0.69% | 0.00% | NA |
| All Japonica | 1512 | 88.00% | 6.80% | 5.16% | 0.00% | NA |
| Aus | 269 | 95.90% | 3.70% | 0.37% | 0.00% | NA |
| Indica I | 595 | 98.20% | 0.00% | 1.85% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.00% | 0.43% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.30% | 0.90% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 84.10% | 11.10% | 4.82% | 0.00% | NA |
| Tropical Japonica | 504 | 92.90% | 2.00% | 5.16% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.50% | 3.30% | 6.22% | 0.00% | NA |
| VI/Aromatic | 96 | 84.40% | 11.50% | 4.17% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 3.30% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0422820213 | A -> G | LOC_Os04g38360.1 | upstream_gene_variant ; 817.0bp to feature; MODIFIER | silent_mutation | Average:16.875; most accessible tissue: Zhenshan97 flower, score: 24.143 | N | N | N | N |
| vg0422820213 | A -> G | LOC_Os04g38370.1 | upstream_gene_variant ; 2055.0bp to feature; MODIFIER | silent_mutation | Average:16.875; most accessible tissue: Zhenshan97 flower, score: 24.143 | N | N | N | N |
| vg0422820213 | A -> G | LOC_Os04g38350-LOC_Os04g38360 | intergenic_region ; MODIFIER | silent_mutation | Average:16.875; most accessible tissue: Zhenshan97 flower, score: 24.143 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0422820213 | 4.31E-06 | NA | mr1403_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0422820213 | NA | 3.86E-06 | mr1403_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |