\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0422607855:

Variant ID: vg0422607855 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 22607855
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTTTCTAAAAGTTGCATGTCGTAATCTTGAGACGACGGTCATGCAACTGTTTGCCAACTATGGATGGAGATTCACAAATAAGCTTGAATAAATGTGTTCT[C/G]
CTTGGTTTGGTTTCTTCATTTTTATGGTTGGTGTGTTCTTCTATTTATGGACTACACTCTATTCTAGGGTGCTACTGTGCTAGTTTGTAATAATTAGCTG

Reverse complement sequence

CAGCTAATTATTACAAACTAGCACAGTAGCACCCTAGAATAGAGTGTAGTCCATAAATAGAAGAACACACCAACCATAAAAATGAAGAAACCAAACCAAG[G/C]
AGAACACATTTATTCAAGCTTATTTGTGAATCTCCATCCATAGTTGGCAAACAGTTGCATGACCGTCGTCTCAAGATTACGACATGCAACTTTTAGAAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.60% 2.20% 1.27% 0.00% NA
All Indica  2759 94.20% 3.70% 2.07% 0.00% NA
All Japonica  1512 99.80% 0.00% 0.20% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 81.70% 12.40% 5.88% 0.00% NA
Indica II  465 97.00% 0.90% 2.15% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 95.30% 3.20% 1.53% 0.00% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0422607855 C -> G LOC_Os04g37990.1 upstream_gene_variant ; 3988.0bp to feature; MODIFIER silent_mutation Average:36.112; most accessible tissue: Zhenshan97 young leaf, score: 50.669 N N N N
vg0422607855 C -> G LOC_Os04g37980-LOC_Os04g37990 intergenic_region ; MODIFIER silent_mutation Average:36.112; most accessible tissue: Zhenshan97 young leaf, score: 50.669 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0422607855 NA 1.71E-15 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422607855 NA 4.07E-14 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422607855 1.01E-06 4.97E-21 mr1389 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422607855 NA 3.55E-17 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422607855 NA 8.80E-08 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422607855 NA 3.62E-20 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422607855 NA 2.59E-17 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422607855 NA 6.46E-06 mr1152_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422607855 NA 7.01E-17 mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422607855 NA 8.46E-15 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422607855 NA 1.87E-07 mr1521_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422607855 NA 2.89E-07 mr1743_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422607855 NA 4.19E-07 mr1743_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422607855 NA 4.91E-07 mr1968_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251