Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0422607855:

Variant ID: vg0422607855 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 22607855
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTTTCTAAAAGTTGCATGTCGTAATCTTGAGACGACGGTCATGCAACTGTTTGCCAACTATGGATGGAGATTCACAAATAAGCTTGAATAAATGTGTTCT[C/G]
CTTGGTTTGGTTTCTTCATTTTTATGGTTGGTGTGTTCTTCTATTTATGGACTACACTCTATTCTAGGGTGCTACTGTGCTAGTTTGTAATAATTAGCTG

Reverse complement sequence

CAGCTAATTATTACAAACTAGCACAGTAGCACCCTAGAATAGAGTGTAGTCCATAAATAGAAGAACACACCAACCATAAAAATGAAGAAACCAAACCAAG[G/C]
AGAACACATTTATTCAAGCTTATTTGTGAATCTCCATCCATAGTTGGCAAACAGTTGCATGACCGTCGTCTCAAGATTACGACATGCAACTTTTAGAAAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.60%	2.20%	1.27%	0.00%	NA
All Indica	2759	94.20%	3.70%	2.07%	0.00%	NA
All Japonica	1512	99.80%	0.00%	0.20%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	81.70%	12.40%	5.88%	0.00%	NA
Indica II	465	97.00%	0.90%	2.15%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	95.30%	3.20%	1.53%	0.00%	NA
Temperate Japonica	767	99.90%	0.00%	0.13%	0.00%	NA
Tropical Japonica	504	99.80%	0.00%	0.20%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	100.00%	0.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0422607855	C -> G	LOC_Os04g37990.1	upstream_gene_variant ; 3988.0bp to feature; MODIFIER	silent_mutation	Average:36.112; most accessible tissue: Zhenshan97 young leaf, score: 50.669	N	N	N	N
vg0422607855	C -> G	LOC_Os04g37980-LOC_Os04g37990	intergenic_region ; MODIFIER	silent_mutation	Average:36.112; most accessible tissue: Zhenshan97 young leaf, score: 50.669	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0422607855	NA	1.71E-15	mr1038	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422607855	NA	4.07E-14	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422607855	1.01E-06	4.97E-21	mr1389	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422607855	NA	3.55E-17	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422607855	NA	8.80E-08	mr1002_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422607855	NA	3.62E-20	mr1038_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422607855	NA	2.59E-17	mr1038_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422607855	NA	6.46E-06	mr1152_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422607855	NA	7.01E-17	mr1389_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422607855	NA	8.46E-15	mr1389_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422607855	NA	1.87E-07	mr1521_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422607855	NA	2.89E-07	mr1743_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422607855	NA	4.19E-07	mr1743_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422607855	NA	4.91E-07	mr1968_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251