Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0422578975:

Variant ID: vg0422578975 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 22578975
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACGGAAGAGCCAGCACAGGGGGTCCCTCGCTTCGACGGCACCCGGAGCTCAACTTAAGGCTGGAATACGGCTAGAAAACTTAGCCCCCATACTTGGCGAG[G/A]
AAACGTTCATGTAGATGAGAGAGAGGTTGGGCTCTTACCACCGAGGAAGCAAACGAATGCGCAACACGCGAGCGTCGCAGGGCCATGAGAAAAGAATGGG

Reverse complement sequence

CCCATTCTTTTCTCATGGCCCTGCGACGCTCGCGTGTTGCGCATTCGTTTGCTTCCTCGGTGGTAAGAGCCCAACCTCTCTCTCATCTACATGAACGTTT[C/T]
CTCGCCAAGTATGGGGGCTAAGTTTTCTAGCCGTATTCCAGCCTTAAGTTGAGCTCCGGGTGCCGTCGAAGCGAGGGACCCCCTGTGCTGGCTCTTCCGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.20%	6.60%	0.25%	0.89%	NA
All Indica	2759	93.90%	4.60%	0.36%	1.09%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	30.10%	65.10%	0.74%	4.09%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	97.40%	1.70%	0.43%	0.43%	NA
Indica III	913	91.70%	4.80%	0.66%	2.85%	NA
Indica Intermediate	786	89.90%	9.50%	0.25%	0.25%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	93.30%	5.60%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0422578975	G -> DEL	N	N	silent_mutation	Average:46.713; most accessible tissue: Minghui63 young leaf, score: 66.656	N	N	N	N
vg0422578975	G -> A	LOC_Os04g37960.1	upstream_gene_variant ; 4481.0bp to feature; MODIFIER	silent_mutation	Average:46.713; most accessible tissue: Minghui63 young leaf, score: 66.656	N	N	N	N
vg0422578975	G -> A	LOC_Os04g37950-LOC_Os04g37960	intergenic_region ; MODIFIER	silent_mutation	Average:46.713; most accessible tissue: Minghui63 young leaf, score: 66.656	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0422578975	NA	2.20E-07	mr1053	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422578975	NA	8.25E-06	mr1054	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422578975	NA	3.16E-06	mr1058	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422578975	NA	1.57E-13	mr1166	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422578975	NA	2.09E-07	mr1207	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422578975	NA	3.87E-06	mr1230	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422578975	NA	3.86E-10	mr1232	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422578975	NA	3.50E-07	mr1262	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422578975	NA	5.73E-07	mr1286	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422578975	NA	2.41E-06	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422578975	NA	9.70E-07	mr1353	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422578975	1.78E-06	1.30E-09	mr1393	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422578975	NA	7.74E-07	mr1400	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422578975	NA	1.96E-08	mr1403	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422578975	NA	2.52E-08	mr1442	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422578975	NA	3.40E-06	mr1512	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422578975	NA	4.91E-19	mr1515	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422578975	NA	9.59E-06	mr1596	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422578975	NA	4.13E-07	mr1634	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422578975	NA	1.23E-06	mr1665	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422578975	NA	1.51E-09	mr1722	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422578975	NA	5.87E-07	mr1759	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422578975	NA	9.48E-06	mr1774	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422578975	NA	7.63E-06	mr1791	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422578975	NA	2.63E-06	mr1906	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422578975	NA	1.03E-09	mr1939	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422578975	NA	9.42E-06	mr1985	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251