Variant ID: vg0422509805 (JBrowse) | Variation Type: SNP |
Chromosome: chr04 | Position: 22509805 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, others allele: 0.00, population size: 107. )
TCCGGTGGAAACGGCTTCGGTTGAGAGGGTCTTGTCAGCTGTCTCTTATAAAGACAGATTTGCGAAACAAAATAGGGGATGAATGACTCAATGACTTGAT[G/A]
ATTTGCTACACTGAGAAGCAGATTTTTAGAAGTATTAGTGATGAAAACATCATCCAACACTTTTAAGAGATGAAAAAGCGCCGTATGCTAGTGCCTCAAC
GTTGAGGCACTAGCATACGGCGCTTTTTCATCTCTTAAAAGTGTTGGATGATGTTTTCATCACTAATACTTCTAAAAATCTGCTTCTCAGTGTAGCAAAT[C/T]
ATCAAGTCATTGAGTCATTCATCCCCTATTTTGTTTCGCAAATCTGTCTTTATAAGAGACAGCTGACAAGACCCTCTCAACCGAAGCCGTTTCCACCGGA
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 29.70% | 2.50% | 9.10% | 58.68% | NA |
All Indica | 2759 | 7.00% | 4.10% | 11.27% | 77.60% | NA |
All Japonica | 1512 | 72.70% | 0.10% | 7.01% | 20.24% | NA |
Aus | 269 | 1.50% | 0.00% | 1.12% | 97.40% | NA |
Indica I | 595 | 7.90% | 1.70% | 8.57% | 81.85% | NA |
Indica II | 465 | 1.70% | 3.20% | 5.81% | 89.25% | NA |
Indica III | 913 | 6.40% | 7.80% | 17.74% | 68.13% | NA |
Indica Intermediate | 786 | 10.20% | 2.30% | 9.03% | 78.50% | NA |
Temperate Japonica | 767 | 76.90% | 0.00% | 1.96% | 21.12% | NA |
Tropical Japonica | 504 | 67.50% | 0.20% | 14.09% | 18.25% | NA |
Japonica Intermediate | 241 | 70.10% | 0.00% | 8.30% | 21.58% | NA |
VI/Aromatic | 96 | 82.30% | 0.00% | 0.00% | 17.71% | NA |
Intermediate | 90 | 33.30% | 3.30% | 11.11% | 52.22% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0422509805 | G -> DEL | N | N | silent_mutation | Average:16.369; most accessible tissue: Callus, score: 49.78 | N | N | N | N |
vg0422509805 | G -> A | LOC_Os04g37840-LOC_Os04g37850 | intergenic_region ; MODIFIER | silent_mutation | Average:16.369; most accessible tissue: Callus, score: 49.78 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0422509805 | NA | 1.38E-06 | mr1538 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0422509805 | 2.08E-08 | 3.35E-10 | mr1547 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0422509805 | 8.54E-07 | 1.21E-08 | mr1547 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0422509805 | 2.81E-11 | 2.43E-14 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0422509805 | 3.44E-09 | 5.55E-17 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0422509805 | NA | 3.45E-07 | mr1538_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0422509805 | 1.46E-07 | 3.14E-09 | mr1547_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0422509805 | 1.41E-07 | 1.70E-09 | mr1547_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0422509805 | 2.99E-12 | 3.66E-24 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0422509805 | 4.85E-09 | 2.38E-21 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |