\
| Variant ID: vg0422260209 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 22260209 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 350. )
CTTCTGATGAAATTTTGCAGTTGTTATTGAGGAAATTCAAGAGGATGACAAGCCTGCTGCTGGTGGAGCACAAAAGGGATCAAACAAGAAGCAAACCAGC[G/A]
AAAATGGTGATGATTCTAAACTGCAGCTTGTTGTTAGGACTCCACCTGCTGAATCTTTGGAAAGCGAAGATGAAGATGGCTTTCCTGTATCATTTTCTGA
TCAGAAAATGATACAGGAAAGCCATCTTCATCTTCGCTTTCCAAAGATTCAGCAGGTGGAGTCCTAACAACAAGCTGCAGTTTAGAATCATCACCATTTT[C/T]
GCTGGTTTGCTTCTTGTTTGATCCCTTTTGTGCTCCACCAGCAGCAGGCTTGTCATCCTCTTGAATTTCCTCAATAACAACTGCAAAATTTCATCAGAAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.30% | 2.50% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 92.10% | 7.50% | 0.40% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.10% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 98.40% | 1.40% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 81.00% | 18.70% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.40% | 3.30% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0422260209 | G -> A | LOC_Os04g36890.1 | missense_variant ; p.Glu210Lys; MODERATE | nonsynonymous_codon ; E210K | Average:44.531; most accessible tissue: Callus, score: 79.393 | benign |
0.278 |
TOLERATED | 0.19 |
| vg0422260209 | G -> A | LOC_Os04g36890.2 | missense_variant ; p.Glu39Lys; MODERATE | nonsynonymous_codon ; E39K | Average:44.531; most accessible tissue: Callus, score: 79.393 | benign |
0.278 |
TOLERATED | 0.33 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0422260209 | 1.68E-06 | 1.68E-06 | mr1085 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0422260209 | NA | 1.08E-06 | mr1104 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0422260209 | 7.69E-08 | 2.64E-09 | mr1155 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0422260209 | NA | 2.40E-07 | mr1213 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0422260209 | NA | 4.83E-09 | mr1248 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0422260209 | 4.70E-06 | 4.70E-06 | mr1264 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0422260209 | NA | 6.03E-06 | mr1277 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0422260209 | NA | 6.45E-12 | mr1410 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0422260209 | NA | 6.03E-07 | mr1411 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0422260209 | NA | 8.28E-07 | mr1437 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0422260209 | NA | 5.51E-07 | mr1620 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0422260209 | NA | 3.52E-08 | mr1746 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0422260209 | NA | 3.32E-06 | mr1155_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |