\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421370963:

Variant ID: vg0421370963 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 21370963
Reference Allele: GAlternative Allele: A,GGACGTCCACCCATTTATTGTATGTCAACT,GCC
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGAGATCCTGCTGGAGTCCTACTTCGTGCAGATCGATGGCACCCTCAACAGCCTCTCCACCGTGAGTAGTTCCTCTCGCCGATGAACGTCAATCATATCT[G/A,GGACGTCCACCCATTTATTGTATGTCAACT,GCC]
GACGTCCACCCATTTATTGTATGTCAACTAAATTATTATAATTTTTTTTTAAAAAAATTAATAAGATAAATCAATATATAATATATCATTCCACGAATAT

Reverse complement sequence

ATATTCGTGGAATGATATATTATATATTGATTTATCTTATTAATTTTTTTAAAAAAAAATTATAATAATTTAGTTGACATACAATAAATGGGTGGACGTC[C/T,AGTTGACATACAATAAATGGGTGGACGTCC,GGC]
AGATATGATTGACGTTCATCGGCGAGAGGAACTACTCACGGTGGAGAGGCTGTTGAGGGTGCCATCGATCTGCACGAAGTAGGACTCCAGCAGGATCTCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.00% 14.60% 0.06% 0.00% GCC: 0.17%; GGACGTCCACCCATTTATTGTATGTCAACT: 0.13%
All Indica  2759 77.30% 22.10% 0.11% 0.00% GCC: 0.25%; GGACGTCCACCCATTTATTGTATGTCAACT: 0.22%
All Japonica  1512 98.70% 1.30% 0.00% 0.00% NA
Aus  269 96.30% 3.30% 0.00% 0.00% GCC: 0.37%
Indica I  595 82.40% 17.50% 0.17% 0.00% NA
Indica II  465 78.70% 21.30% 0.00% 0.00% NA
Indica III  913 71.70% 26.70% 0.11% 0.00% GCC: 0.77%; GGACGTCCACCCATTTATTGTATGTCAACT: 0.66%
Indica Intermediate  786 79.00% 20.90% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 96.20% 3.80% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 57.30% 42.70% 0.00% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0421370963 G -> GGACGTCCACCCATTTATTGTATGTCAACT LOC_Os04g35170.1 upstream_gene_variant ; 2546.0bp to feature; MODIFIER silent_mutation Average:65.437; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N
vg0421370963 G -> GGACGTCCACCCATTTATTGTATGTCAACT LOC_Os04g35160.1 intron_variant ; MODIFIER silent_mutation Average:65.437; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N
vg0421370963 G -> A LOC_Os04g35170.1 upstream_gene_variant ; 2547.0bp to feature; MODIFIER silent_mutation Average:65.437; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N
vg0421370963 G -> A LOC_Os04g35160.1 intron_variant ; MODIFIER silent_mutation Average:65.437; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N
vg0421370963 G -> GCC LOC_Os04g35170.1 upstream_gene_variant ; 2546.0bp to feature; MODIFIER silent_mutation Average:65.437; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N
vg0421370963 G -> GCC LOC_Os04g35160.1 intron_variant ; MODIFIER silent_mutation Average:65.437; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0421370963 9.07E-06 NA mr1245_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421370963 NA 4.63E-06 mr1245_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421370963 1.20E-07 1.20E-07 mr1267_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421370963 2.57E-06 2.57E-06 mr1311_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421370963 1.16E-06 1.16E-06 mr1329_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421370963 2.49E-06 2.49E-06 mr1337_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421370963 3.70E-06 NA mr1373_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421370963 2.64E-06 6.12E-07 mr1373_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421370963 NA 6.13E-06 mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421370963 NA 6.12E-06 mr1648_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421370963 3.83E-06 3.83E-06 mr1674_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421370963 NA 7.39E-06 mr1683_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421370963 1.94E-06 1.94E-06 mr1688_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421370963 8.84E-06 8.84E-06 mr1697_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421370963 5.90E-06 5.90E-06 mr1760_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421370963 5.56E-06 5.56E-06 mr1833_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421370963 9.02E-06 9.02E-06 mr1847_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251