Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421353471:

Variant ID: vg0421353471 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 21353471
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.84, C: 0.16, others allele: 0.00, population size: 31. )

Flanking Sequence (100 bp) in Reference Genome:


GTGCCGTGTAGCCCGGCGTTGCTTCCATTTCTGACGCTCTTTGCCTGTTCTGATCTTCTGTTCCAGCACGACAGCGGCCAGATCCAGTACTTAGGCCCTG[T/C]
TTAGATGGGACTAAAACTTTTGAGTCCCTATCACATCGGATGTTTGAAAATTAATTATAAATATTAAACGTAGACTATTAATAAAACCCATCCATAATCT

Reverse complement sequence

AGATTATGGATGGGTTTTATTAATAGTCTACGTTTAATATTTATAATTAATTTTCAAACATCCGATGTGATAGGGACTCAAAAGTTTTAGTCCCATCTAA[A/G]
CAGGGCCTAAGTACTGGATCTGGCCGCTGTCGTGCTGGAACAGAAGATCAGAACAGGCAAAGAGCGTCAGAAATGGAAGCAACGCCGGGCTACACGGCAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.30% 6.90% 1.25% 55.54% NA
All Indica  2759 13.70% 2.80% 1.88% 81.62% NA
All Japonica  1512 79.80% 14.30% 0.13% 5.82% NA
Aus  269 24.90% 0.00% 1.49% 73.61% NA
Indica I  595 12.40% 6.60% 1.18% 79.83% NA
Indica II  465 3.70% 0.00% 0.65% 95.70% NA
Indica III  913 18.60% 1.80% 0.55% 79.08% NA
Indica Intermediate  786 15.00% 2.70% 4.71% 77.61% NA
Temperate Japonica  767 85.80% 5.30% 0.26% 8.60% NA
Tropical Japonica  504 84.90% 10.90% 0.00% 4.17% NA
Japonica Intermediate  241 49.80% 49.80% 0.00% 0.41% NA
VI/Aromatic  96 16.70% 27.10% 1.04% 55.21% NA
Intermediate  90 53.30% 8.90% 0.00% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0421353471 T -> C LOC_Os04g35130.1 downstream_gene_variant ; 211.0bp to feature; MODIFIER silent_mutation Average:83.823; most accessible tissue: Zhenshan97 flower, score: 97.188 N N N N
vg0421353471 T -> C LOC_Os04g35130-LOC_Os04g35140 intergenic_region ; MODIFIER silent_mutation Average:83.823; most accessible tissue: Zhenshan97 flower, score: 97.188 N N N N
vg0421353471 T -> DEL N N silent_mutation Average:83.823; most accessible tissue: Zhenshan97 flower, score: 97.188 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0421353471 T C -0.02 -0.03 -0.02 -0.02 -0.01 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0421353471 3.91E-06 NA Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0421353471 2.74E-06 NA Plant_height Jap_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0421353471 NA 2.59E-07 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421353471 NA 6.42E-07 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421353471 NA 5.02E-06 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421353471 NA 2.40E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421353471 NA 4.98E-06 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421353471 NA 1.16E-06 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421353471 NA 1.67E-07 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421353471 NA 3.65E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421353471 NA 3.38E-06 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421353471 NA 2.07E-06 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421353471 NA 5.07E-06 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421353471 NA 1.08E-07 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421353471 NA 1.17E-07 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251