Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0421309810:

Variant ID: vg0421309810 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 21309810
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.67, A: 0.33, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:

ACAAACTTGAAAAATGGATTAATCTGATATTTTAGAAAAACTTTCATATAAAAAATTTTCACACGAAACACACTGTTTAGTGGTTTAAAAAACGTGCCAT[A/G]
AAAATCCAAATCTTAATCCAACCTTTCCAGAGGAAATGAACGGGGCCGACACAGAATTATCCTAAGGCCCTGTTTAGATGGGACTAAAACTTTTAAGTCC

Reverse complement sequence

GGACTTAAAAGTTTTAGTCCCATCTAAACAGGGCCTTAGGATAATTCTGTGTCGGCCCCGTTCATTTCCTCTGGAAAGGTTGGATTAAGATTTGGATTTT[T/C]
ATGGCACGTTTTTTAAACCACTAAACAGTGTGTTTCGTGTGAAAATTTTTTATATGAAAGTTTTTCTAAAATATCAGATTAATCCATTTTTCAAGTTTGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.80%	46.10%	0.15%	0.00%	NA
All Indica	2759	39.00%	60.90%	0.18%	0.00%	NA
All Japonica	1512	81.10%	18.90%	0.00%	0.00%	NA
Aus	269	61.70%	37.90%	0.37%	0.00%	NA
Indica I	595	29.20%	70.60%	0.17%	0.00%	NA
Indica II	465	22.40%	77.40%	0.22%	0.00%	NA
Indica III	913	51.40%	48.60%	0.00%	0.00%	NA
Indica Intermediate	786	41.70%	57.90%	0.38%	0.00%	NA
Temperate Japonica	767	86.40%	13.60%	0.00%	0.00%	NA
Tropical Japonica	504	84.70%	15.30%	0.00%	0.00%	NA
Japonica Intermediate	241	56.40%	43.60%	0.00%	0.00%	NA
VI/Aromatic	96	18.80%	81.20%	0.00%	0.00%	NA
Intermediate	90	63.30%	35.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0421309810	A -> G	LOC_Os04g35060.1	upstream_gene_variant ; 620.0bp to feature; MODIFIER	silent_mutation	Average:54.759; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N
vg0421309810	A -> G	LOC_Os04g35050-LOC_Os04g35060	intergenic_region ; MODIFIER	silent_mutation	Average:54.759; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0421309810	NA	1.37E-06	mr1180	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421309810	NA	3.55E-06	mr1072_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421309810	NA	3.64E-06	mr1075_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421309810	NA	2.41E-06	mr1149_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421309810	NA	2.92E-06	mr1159_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421309810	NA	2.32E-06	mr1184_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421309810	7.39E-06	7.39E-06	mr1267_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421309810	NA	6.01E-09	mr1277_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421309810	NA	8.34E-06	mr1278_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421309810	7.33E-06	7.33E-06	mr1311_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421309810	2.85E-07	2.85E-07	mr1312_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421309810	NA	6.68E-07	mr1378_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421309810	NA	3.15E-06	mr1428_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421309810	NA	7.58E-06	mr1441_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421309810	NA	9.03E-06	mr1641_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421309810	NA	6.79E-06	mr1648_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421309810	NA	9.34E-08	mr1653_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421309810	7.48E-06	7.47E-06	mr1663_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421309810	2.69E-06	2.68E-06	mr1665_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421309810	NA	4.23E-06	mr1669_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421309810	NA	6.81E-06	mr1682_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421309810	2.79E-06	8.61E-08	mr1683_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421309810	1.20E-06	1.19E-06	mr1687_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421309810	1.88E-07	1.88E-07	mr1738_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421309810	NA	2.53E-07	mr1759_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421309810	NA	3.29E-07	mr1766_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421309810	1.58E-06	1.58E-06	mr1812_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421309810	1.45E-06	1.45E-06	mr1833_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421309810	2.78E-07	2.78E-07	mr1983_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251