\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0420877857:

Variant ID: vg0420877857 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 20877857
Reference Allele: CAlternative Allele: G
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.87, C: 0.13, others allele: 0.00, population size: 53. )

Flanking Sequence (100 bp) in Reference Genome:


GGGACGGCGCCAGCTGCTCTGGCGCCGTCCTCCTGCCACCGTGGCGCACGCGAACCGATGTGGCAGGAGGAGGGCGCCAGCCATGCTGGCGCCGCCCCAG[C/G]
CTAGTGCCGCCGCCTCCATTCCTGTTTCTCTGTATGGAGTTGCAACGGTGTCATTTTTATTTTATTTTTTCGGATGTTTTTTCACACTCAGGATCACGAT

Reverse complement sequence

ATCGTGATCCTGAGTGTGAAAAAACATCCGAAAAAATAAAATAAAAATGACACCGTTGCAACTCCATACAGAGAAACAGGAATGGAGGCGGCGGCACTAG[G/C]
CTGGGGCGGCGCCAGCATGGCTGGCGCCCTCCTCCTGCCACATCGGTTCGCGTGCGCCACGGTGGCAGGAGGACGGCGCCAGAGCAGCTGGCGCCGTCCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.80% 22.20% 1.97% 4.97% NA
All Indica  2759 98.50% 1.30% 0.07% 0.07% NA
All Japonica  1512 16.70% 62.80% 5.22% 15.28% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 97.40% 2.40% 0.00% 0.22% NA
Indica III  913 99.70% 0.10% 0.11% 0.11% NA
Indica Intermediate  786 97.10% 2.80% 0.13% 0.00% NA
Temperate Japonica  767 5.20% 81.20% 3.13% 10.43% NA
Tropical Japonica  504 33.70% 34.90% 7.74% 23.61% NA
Japonica Intermediate  241 17.40% 62.70% 6.64% 13.28% NA
VI/Aromatic  96 57.30% 35.40% 7.29% 0.00% NA
Intermediate  90 60.00% 33.30% 4.44% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0420877857 C -> DEL N N silent_mutation Average:46.203; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg0420877857 C -> G LOC_Os04g34460.1 downstream_gene_variant ; 1487.0bp to feature; MODIFIER silent_mutation Average:46.203; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg0420877857 C -> G LOC_Os04g34470.1 downstream_gene_variant ; 163.0bp to feature; MODIFIER silent_mutation Average:46.203; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg0420877857 C -> G LOC_Os04g34480.1 downstream_gene_variant ; 2929.0bp to feature; MODIFIER silent_mutation Average:46.203; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg0420877857 C -> G LOC_Os04g34490.1 downstream_gene_variant ; 4420.0bp to feature; MODIFIER silent_mutation Average:46.203; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg0420877857 C -> G LOC_Os04g34470-LOC_Os04g34480 intergenic_region ; MODIFIER silent_mutation Average:46.203; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0420877857 NA 1.33E-07 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420877857 NA 6.76E-08 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420877857 NA 1.28E-21 mr1163 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420877857 NA 2.31E-10 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420877857 NA 4.04E-36 mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420877857 NA 1.12E-06 mr1502 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420877857 NA 8.15E-07 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420877857 NA 8.20E-09 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420877857 NA 2.31E-10 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420877857 NA 6.06E-06 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420877857 NA 2.07E-13 mr1740 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420877857 NA 2.73E-12 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420877857 NA 3.81E-07 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420877857 NA 4.71E-08 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420877857 2.28E-07 1.30E-21 mr1768 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420877857 NA 4.85E-07 mr1768 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420877857 NA 8.08E-08 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420877857 NA 4.02E-08 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420877857 NA 7.05E-06 mr1821 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420877857 NA 3.03E-06 mr1858 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420877857 NA 3.04E-06 mr1859 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420877857 NA 9.84E-06 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420877857 NA 8.36E-27 mr1768_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251