Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0420877857:

Variant ID: vg0420877857 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 20877857
Reference Allele: C	Alternative Allele: G
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.87, C: 0.13, others allele: 0.00, population size: 53. )

Flanking Sequence (100 bp) in Reference Genome:

GGGACGGCGCCAGCTGCTCTGGCGCCGTCCTCCTGCCACCGTGGCGCACGCGAACCGATGTGGCAGGAGGAGGGCGCCAGCCATGCTGGCGCCGCCCCAG[C/G]
CTAGTGCCGCCGCCTCCATTCCTGTTTCTCTGTATGGAGTTGCAACGGTGTCATTTTTATTTTATTTTTTCGGATGTTTTTTCACACTCAGGATCACGAT

Reverse complement sequence

ATCGTGATCCTGAGTGTGAAAAAACATCCGAAAAAATAAAATAAAAATGACACCGTTGCAACTCCATACAGAGAAACAGGAATGGAGGCGGCGGCACTAG[G/C]
CTGGGGCGGCGCCAGCATGGCTGGCGCCCTCCTCCTGCCACATCGGTTCGCGTGCGCCACGGTGGCAGGAGGACGGCGCCAGAGCAGCTGGCGCCGTCCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.80%	22.20%	1.97%	4.97%	NA
All Indica	2759	98.50%	1.30%	0.07%	0.07%	NA
All Japonica	1512	16.70%	62.80%	5.22%	15.28%	NA
Aus	269	99.60%	0.00%	0.37%	0.00%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	97.40%	2.40%	0.00%	0.22%	NA
Indica III	913	99.70%	0.10%	0.11%	0.11%	NA
Indica Intermediate	786	97.10%	2.80%	0.13%	0.00%	NA
Temperate Japonica	767	5.20%	81.20%	3.13%	10.43%	NA
Tropical Japonica	504	33.70%	34.90%	7.74%	23.61%	NA
Japonica Intermediate	241	17.40%	62.70%	6.64%	13.28%	NA
VI/Aromatic	96	57.30%	35.40%	7.29%	0.00%	NA
Intermediate	90	60.00%	33.30%	4.44%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0420877857	C -> DEL	N	N	silent_mutation	Average:46.203; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N
vg0420877857	C -> G	LOC_Os04g34460.1	downstream_gene_variant ; 1487.0bp to feature; MODIFIER	silent_mutation	Average:46.203; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N
vg0420877857	C -> G	LOC_Os04g34470.1	downstream_gene_variant ; 163.0bp to feature; MODIFIER	silent_mutation	Average:46.203; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N
vg0420877857	C -> G	LOC_Os04g34480.1	downstream_gene_variant ; 2929.0bp to feature; MODIFIER	silent_mutation	Average:46.203; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N
vg0420877857	C -> G	LOC_Os04g34490.1	downstream_gene_variant ; 4420.0bp to feature; MODIFIER	silent_mutation	Average:46.203; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N
vg0420877857	C -> G	LOC_Os04g34470-LOC_Os04g34480	intergenic_region ; MODIFIER	silent_mutation	Average:46.203; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0420877857	NA	1.33E-07	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420877857	NA	6.76E-08	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420877857	NA	1.28E-21	mr1163	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420877857	NA	2.31E-10	mr1471	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420877857	NA	4.04E-36	mr1486	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420877857	NA	1.12E-06	mr1502	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420877857	NA	8.15E-07	mr1543	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420877857	NA	8.20E-09	mr1549	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420877857	NA	2.31E-10	mr1630	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420877857	NA	6.06E-06	mr1704	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420877857	NA	2.07E-13	mr1740	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420877857	NA	2.73E-12	mr1741	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420877857	NA	3.81E-07	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420877857	NA	4.71E-08	mr1757	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420877857	2.28E-07	1.30E-21	mr1768	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420877857	NA	4.85E-07	mr1768	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420877857	NA	8.08E-08	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420877857	NA	4.02E-08	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420877857	NA	7.05E-06	mr1821	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420877857	NA	3.03E-06	mr1858	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420877857	NA	3.04E-06	mr1859	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420877857	NA	9.84E-06	mr1871	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420877857	NA	8.36E-27	mr1768_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251