\
| Variant ID: vg0420836195 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 20836195 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 63. )
ACTTTTCTAAGAAGTTGGGGGGAGGCAGTTTTGGTTCTGTATTTAGAGCAATGCTCCGGTGCTTTCTACCGGTAGTATATACTACCAGTAGAACTAATCT[G/A]
AACCGTTTATTTTTAAGGGTAGATTAGTAAAGTACTGAGGTAGATTTGGGATAAATTTGGCACTTAATTTATTTTTGTCGTGGATCGCTCGGATGTTTCT
AGAAACATCCGAGCGATCCACGACAAAAATAAATTAAGTGCCAAATTTATCCCAAATCTACCTCAGTACTTTACTAATCTACCCTTAAAAATAAACGGTT[C/T]
AGATTAGTTCTACTGGTAGTATATACTACCGGTAGAAAGCACCGGAGCATTGCTCTAAATACAGAACCAAAACTGCCTCCCCCCAACTTCTTAGAAAAGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 27.10% | 15.10% | 32.25% | 25.50% | NA |
| All Indica | 2759 | 7.90% | 24.90% | 45.78% | 21.42% | NA |
| All Japonica | 1512 | 65.00% | 0.40% | 3.84% | 30.75% | NA |
| Aus | 269 | 2.60% | 0.40% | 52.04% | 44.98% | NA |
| Indica I | 595 | 2.70% | 9.90% | 44.71% | 42.69% | NA |
| Indica II | 465 | 13.30% | 44.10% | 20.22% | 22.37% | NA |
| Indica III | 913 | 6.90% | 24.50% | 62.76% | 5.81% | NA |
| Indica Intermediate | 786 | 9.90% | 25.20% | 41.98% | 22.90% | NA |
| Temperate Japonica | 767 | 82.80% | 0.30% | 1.04% | 15.91% | NA |
| Tropical Japonica | 504 | 36.90% | 0.80% | 8.53% | 53.77% | NA |
| Japonica Intermediate | 241 | 67.20% | 0.00% | 2.90% | 29.88% | NA |
| VI/Aromatic | 96 | 37.50% | 11.50% | 38.54% | 12.50% | NA |
| Intermediate | 90 | 41.10% | 12.20% | 28.89% | 17.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0420836195 | G -> DEL | N | N | silent_mutation | Average:55.277; most accessible tissue: Minghui63 flag leaf, score: 66.556 | N | N | N | N |
| vg0420836195 | G -> A | LOC_Os04g34410.1 | intron_variant ; MODIFIER | silent_mutation | Average:55.277; most accessible tissue: Minghui63 flag leaf, score: 66.556 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0420836195 | NA | 3.27E-06 | mr1030 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420836195 | NA | 3.75E-06 | mr1118 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420836195 | 3.76E-06 | 7.30E-08 | mr1311 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420836195 | NA | 6.08E-06 | mr1412 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420836195 | NA | 7.92E-06 | mr1502 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420836195 | NA | 6.56E-07 | mr1568 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420836195 | NA | 3.60E-06 | mr1596 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420836195 | NA | 4.22E-06 | mr1621 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420836195 | 2.20E-07 | 2.19E-07 | mr1674 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420836195 | NA | 3.36E-07 | mr1763 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420836195 | NA | 1.31E-06 | mr1768 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420836195 | NA | 6.93E-06 | mr1858 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420836195 | NA | 6.95E-06 | mr1859 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420836195 | NA | 6.18E-06 | mr1872 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |