\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0420778366:

Variant ID: vg0420778366 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 20778366
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


ATGTGCCCGTACAAAATGAGTACATTTCCCGTAATACGGGAGGTCTCTACTTTCTCAGATAATTTATTGGCGTTCGTATAGGTGTGCACTCATGGGTGTG[T/C]
GTGTGAATGGTCTGACTGTGGTGTATCTTCCATTATAGGCCGTGTTTAGTTTCAAAGTTTTTCTTCAAACTTCTAACTTTTCTATCACATCGAAACTTTC

Reverse complement sequence

GAAAGTTTCGATGTGATAGAAAAGTTAGAAGTTTGAAGAAAAACTTTGAAACTAAACACGGCCTATAATGGAAGATACACCACAGTCAGACCATTCACAC[A/G]
CACACCCATGAGTGCACACCTATACGAACGCCAATAAATTATCTGAGAAAGTAGAGACCTCCCGTATTACGGGAAATGTACTCATTTTGTACGGGCACAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.80% 38.30% 0.25% 12.65% NA
All Indica  2759 81.70% 17.10% 0.04% 1.09% NA
All Japonica  1512 0.90% 66.30% 0.40% 32.41% NA
Aus  269 2.20% 77.70% 0.74% 19.33% NA
Indica I  595 96.30% 3.50% 0.00% 0.17% NA
Indica II  465 76.80% 21.50% 0.00% 1.72% NA
Indica III  913 76.70% 22.50% 0.00% 0.88% NA
Indica Intermediate  786 79.50% 18.70% 0.13% 1.65% NA
Temperate Japonica  767 0.50% 82.90% 0.13% 16.43% NA
Tropical Japonica  504 1.20% 40.70% 0.99% 57.14% NA
Japonica Intermediate  241 1.20% 67.20% 0.00% 31.54% NA
VI/Aromatic  96 4.20% 85.40% 2.08% 8.33% NA
Intermediate  90 28.90% 50.00% 1.11% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0420778366 T -> C LOC_Os04g34300.1 upstream_gene_variant ; 845.0bp to feature; MODIFIER silent_mutation Average:50.182; most accessible tissue: Callus, score: 72.051 N N N N
vg0420778366 T -> C LOC_Os04g34290-LOC_Os04g34300 intergenic_region ; MODIFIER silent_mutation Average:50.182; most accessible tissue: Callus, score: 72.051 N N N N
vg0420778366 T -> DEL N N silent_mutation Average:50.182; most accessible tissue: Callus, score: 72.051 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0420778366 NA 8.29E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420778366 NA 1.50E-06 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420778366 NA 4.69E-12 mr1169 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420778366 NA 1.58E-13 mr1270 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420778366 NA 3.67E-12 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420778366 NA 5.75E-08 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420778366 NA 9.05E-07 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420778366 NA 2.40E-09 mr1379 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420778366 NA 9.67E-19 mr1552 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420778366 NA 2.70E-18 mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420778366 NA 1.76E-13 mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420778366 NA 5.93E-10 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420778366 NA 1.84E-15 mr1655 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420778366 NA 1.80E-11 mr1657 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420778366 NA 2.82E-20 mr1700 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420778366 NA 1.07E-07 mr1717 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420778366 NA 2.58E-06 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420778366 NA 5.21E-10 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420778366 NA 4.60E-10 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420778366 NA 2.89E-10 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420778366 NA 1.49E-07 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420778366 NA 4.91E-06 mr1876 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420778366 NA 2.19E-09 mr1946 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420778366 NA 3.33E-15 mr1578_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420778366 NA 3.28E-19 mr1581_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420778366 NA 1.31E-31 mr1598_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420778366 NA 2.54E-23 mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420778366 NA 3.34E-10 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420778366 NA 2.54E-14 mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420778366 NA 9.21E-10 mr1782_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420778366 NA 4.39E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420778366 NA 3.14E-17 mr1836_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420778366 NA 9.43E-07 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251