\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0420664918:

Variant ID: vg0420664918 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 20664918
Reference Allele: GAlternative Allele: GATAA,A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCATGGCATTGTTAGAAAAGAGTCTGGTAGTGATACTACATTTGAGCCCCCTTGATTCCATGAGGAAGCAATATAAGAGCAGGTACAATAGCAGGATACA[G/GATAA,A]
CTGTAAATATATTTTAAGAAAATAAATGAGAAGAGAGAAGAGGAGCGGGCTACAGATTTATAGCCAACTGTAGCACGGACTCCAAGACATATGGTGTGTA

Reverse complement sequence

TACACACCATATGTCTTGGAGTCCGTGCTACAGTTGGCTATAAATCTGTAGCCCGCTCCTCTTCTCTCTTCTCATTTATTTTCTTAAAATATATTTACAG[C/TTATC,T]
TGTATCCTGCTATTGTACCTGCTCTTATATTGCTTCCTCATGGAATCAAGGGGGCTCAAATGTAGTATCACTACCAGACTCTTTTCTAACAATGCCATGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.10% 39.00% 5.69% 0.11% GATAA: 9.12%
All Indica  2759 9.20% 65.70% 9.42% 0.11% GATAA: 15.48%
All Japonica  1512 99.40% 0.20% 0.20% 0.13% GATAA: 0.07%
Aus  269 97.80% 1.90% 0.00% 0.00% GATAA: 0.37%
Indica I  595 4.70% 46.20% 23.87% 0.00% GATAA: 25.21%
Indica II  465 7.70% 78.70% 7.10% 0.43% GATAA: 6.02%
Indica III  913 9.10% 75.00% 0.99% 0.00% GATAA: 14.90%
Indica Intermediate  786 13.70% 62.10% 9.67% 0.13% GATAA: 14.38%
Temperate Japonica  767 99.70% 0.10% 0.13% 0.00% NA
Tropical Japonica  504 99.00% 0.40% 0.20% 0.20% GATAA: 0.20%
Japonica Intermediate  241 99.20% 0.00% 0.41% 0.41% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 67.80% 23.30% 6.67% 0.00% GATAA: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0420664918 G -> DEL N N silent_mutation Average:78.811; most accessible tissue: Zhenshan97 flower, score: 96.783 N N N N
vg0420664918 G -> A LOC_Os04g34100-LOC_Os04g34110 intergenic_region ; MODIFIER silent_mutation Average:78.811; most accessible tissue: Zhenshan97 flower, score: 96.783 N N N N
vg0420664918 G -> GATAA LOC_Os04g34100-LOC_Os04g34110 intergenic_region ; MODIFIER silent_mutation Average:78.811; most accessible tissue: Zhenshan97 flower, score: 96.783 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0420664918 G A 0.0 -0.01 -0.02 -0.08 -0.07 -0.04
vg0420664918 G GATAA -0.37 0.05 0.01 -0.04 0.16 0.29

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0420664918 NA 2.27E-14 mr1032 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420664918 NA 5.99E-08 mr1125 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420664918 NA 4.85E-15 mr1165 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420664918 NA 2.09E-08 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420664918 NA 1.52E-06 mr1216 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420664918 NA 1.36E-13 mr1478 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420664918 NA 2.87E-10 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420664918 NA 3.40E-07 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420664918 NA 2.08E-21 mr1971 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420664918 NA 5.14E-06 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420664918 NA 9.99E-06 mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420664918 NA 2.73E-09 mr1478_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420664918 NA 1.63E-06 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420664918 NA 1.10E-06 mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420664918 7.65E-06 2.06E-06 mr1648_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420664918 4.09E-06 6.04E-08 mr1655_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420664918 NA 5.79E-06 mr1682_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420664918 4.89E-06 1.80E-08 mr1864_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420664918 NA 1.26E-06 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420664918 NA 7.41E-07 mr1974_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420664918 3.68E-06 3.68E-06 mr1984_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251