\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0420659191:

Variant ID: vg0420659191 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 20659191
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


AAATTTGGTCAAAATTTATCGAAAACCAATCGAAATTTATCAAAAATCGTGATACTGATGGGGCTCAAAATTTAGTGGTCAATCGTTATTGTAAACCCTG[A/G]
ACGGAGGCTAGCAGCAGCAGCTGCACAGGTTATCTTTATTGGCCGTGAATGTGGTGCATTGGCCTCTTTCGTCTGCACCTCTCTGAAACGTCGTCCGCAT

Reverse complement sequence

ATGCGGACGACGTTTCAGAGAGGTGCAGACGAAAGAGGCCAATGCACCACATTCACGGCCAATAAAGATAACCTGTGCAGCTGCTGCTGCTAGCCTCCGT[T/C]
CAGGGTTTACAATAACGATTGACCACTAAATTTTGAGCCCCATCAGTATCACGATTTTTGATAAATTTCGATTGGTTTTCGATAAATTTTGACCAAATTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.60% 34.70% 0.13% 0.53% NA
All Indica  2759 92.80% 6.50% 0.11% 0.58% NA
All Japonica  1512 29.80% 70.00% 0.00% 0.26% NA
Aus  269 3.30% 96.70% 0.00% 0.00% NA
Indica I  595 95.10% 4.40% 0.34% 0.17% NA
Indica II  465 94.00% 5.20% 0.22% 0.65% NA
Indica III  913 94.30% 5.50% 0.00% 0.22% NA
Indica Intermediate  786 88.50% 10.20% 0.00% 1.27% NA
Temperate Japonica  767 34.70% 65.30% 0.00% 0.00% NA
Tropical Japonica  504 8.50% 91.10% 0.00% 0.40% NA
Japonica Intermediate  241 58.50% 40.70% 0.00% 0.83% NA
VI/Aromatic  96 0.00% 100.00% 0.00% 0.00% NA
Intermediate  90 38.90% 52.20% 3.33% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0420659191 A -> DEL N N silent_mutation Average:66.034; most accessible tissue: Callus, score: 87.639 N N N N
vg0420659191 A -> G LOC_Os04g34100.1 downstream_gene_variant ; 1905.0bp to feature; MODIFIER silent_mutation Average:66.034; most accessible tissue: Callus, score: 87.639 N N N N
vg0420659191 A -> G LOC_Os04g34100-LOC_Os04g34110 intergenic_region ; MODIFIER silent_mutation Average:66.034; most accessible tissue: Callus, score: 87.639 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0420659191 A G -0.01 0.02 0.02 0.03 0.04 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0420659191 NA 7.97E-07 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420659191 NA 4.00E-14 mr1270 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420659191 NA 1.29E-10 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420659191 NA 4.71E-08 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420659191 NA 2.33E-07 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420659191 NA 8.93E-22 mr1416 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420659191 NA 9.13E-06 mr1427 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420659191 NA 3.88E-19 mr1552 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420659191 NA 3.70E-09 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420659191 NA 1.16E-13 mr1655 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420659191 NA 1.90E-17 mr1700 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420659191 NA 5.59E-10 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420659191 NA 2.01E-07 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420659191 NA 1.28E-07 mr1717 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420659191 NA 5.58E-07 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420659191 NA 7.35E-09 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420659191 NA 5.35E-09 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420659191 NA 6.78E-15 mr1883 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420659191 NA 8.48E-06 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251