Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0419912370:

Variant ID: vg0419912370 (JBrowse)	Variation Type: INDEL
Chromosome: chr04	Position: 19912370
Reference Allele: T	Alternative Allele: C,TAGTTA
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.58, T: 0.42, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

TAGTTTATTCTTCTATTAAACTTGTTTTAACAACAAGTTTAATAGTATAGCCAGCTACTAGCTCTAAATTATTTATAGTCAATTTAATAGCTAATTCATA[T/C,TAGTTA]
AATAATTAGCTACAAAATATACATACACGTTACTAATTGGTCCCACATATCATACACACACAACGTTTTAAAGTTCGTGCTGCAGCTGGCTACAAATCTG

Reverse complement sequence

CAGATTTGTAGCCAGCTGCAGCACGAACTTTAAAACGTTGTGTGTGTATGATATGTGGGACCAATTAGTAACGTGTATGTATATTTTGTAGCTAATTATT[A/G,TAACTA]
TATGAATTAGCTATTAAATTGACTATAAATAATTTAGAGCTAGTAGCTGGCTATACTATTAAACTTGTTGTTAAAACAAGTTTAATAGAAGAATAAACTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.10%	23.30%	0.61%	0.00%	TAGTTA: 0.02%
All Indica	2759	97.60%	2.20%	0.14%	0.00%	NA
All Japonica	1512	41.80%	56.80%	1.39%	0.00%	NA
Aus	269	50.20%	49.10%	0.37%	0.00%	TAGTTA: 0.37%
Indica I	595	98.70%	1.20%	0.17%	0.00%	NA
Indica II	465	96.30%	3.70%	0.00%	0.00%	NA
Indica III	913	98.60%	1.40%	0.00%	0.00%	NA
Indica Intermediate	786	96.40%	3.20%	0.38%	0.00%	NA
Temperate Japonica	767	18.50%	79.50%	1.96%	0.00%	NA
Tropical Japonica	504	63.30%	36.70%	0.00%	0.00%	NA
Japonica Intermediate	241	71.00%	26.60%	2.49%	0.00%	NA
VI/Aromatic	96	80.20%	19.80%	0.00%	0.00%	NA
Intermediate	90	65.60%	31.10%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0419912370	T -> C	LOC_Os04g32950.1	downstream_gene_variant ; 858.0bp to feature; MODIFIER	silent_mutation	Average:72.44; most accessible tissue: Minghui63 panicle, score: 86.012	N	N	N	N
vg0419912370	T -> C	LOC_Os04g32950.2	downstream_gene_variant ; 858.0bp to feature; MODIFIER	silent_mutation	Average:72.44; most accessible tissue: Minghui63 panicle, score: 86.012	N	N	N	N
vg0419912370	T -> C	LOC_Os04g32950.3	downstream_gene_variant ; 858.0bp to feature; MODIFIER	silent_mutation	Average:72.44; most accessible tissue: Minghui63 panicle, score: 86.012	N	N	N	N
vg0419912370	T -> C	LOC_Os04g32950.4	downstream_gene_variant ; 858.0bp to feature; MODIFIER	silent_mutation	Average:72.44; most accessible tissue: Minghui63 panicle, score: 86.012	N	N	N	N
vg0419912370	T -> C	LOC_Os04g32940-LOC_Os04g32950	intergenic_region ; MODIFIER	silent_mutation	Average:72.44; most accessible tissue: Minghui63 panicle, score: 86.012	N	N	N	N
vg0419912370	T -> TAGTTA	LOC_Os04g32950.1	downstream_gene_variant ; 857.0bp to feature; MODIFIER	silent_mutation	Average:72.44; most accessible tissue: Minghui63 panicle, score: 86.012	N	N	N	N
vg0419912370	T -> TAGTTA	LOC_Os04g32950.2	downstream_gene_variant ; 857.0bp to feature; MODIFIER	silent_mutation	Average:72.44; most accessible tissue: Minghui63 panicle, score: 86.012	N	N	N	N
vg0419912370	T -> TAGTTA	LOC_Os04g32950.3	downstream_gene_variant ; 857.0bp to feature; MODIFIER	silent_mutation	Average:72.44; most accessible tissue: Minghui63 panicle, score: 86.012	N	N	N	N
vg0419912370	T -> TAGTTA	LOC_Os04g32950.4	downstream_gene_variant ; 857.0bp to feature; MODIFIER	silent_mutation	Average:72.44; most accessible tissue: Minghui63 panicle, score: 86.012	N	N	N	N
vg0419912370	T -> TAGTTA	LOC_Os04g32940-LOC_Os04g32950	intergenic_region ; MODIFIER	silent_mutation	Average:72.44; most accessible tissue: Minghui63 panicle, score: 86.012	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0419912370	NA	1.50E-07	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912370	NA	2.15E-06	mr1045_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912370	NA	7.72E-09	mr1051_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912370	NA	1.58E-06	mr1072_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912370	NA	7.98E-06	mr1075_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912370	NA	2.18E-06	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912370	3.46E-06	NA	mr1083_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912370	NA	5.51E-07	mr1084_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912370	1.84E-06	1.84E-06	mr1145_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912370	NA	1.02E-06	mr1149_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912370	NA	1.57E-08	mr1155_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912370	NA	3.96E-07	mr1206_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912370	1.22E-06	NA	mr1226_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912370	NA	1.37E-07	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912370	NA	6.85E-10	mr1229_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912370	NA	5.02E-06	mr1263_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912370	NA	3.37E-06	mr1318_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912370	NA	2.68E-07	mr1405_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912370	7.62E-06	NA	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912370	7.21E-07	NA	mr1408_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912370	NA	3.93E-06	mr1441_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912370	NA	1.45E-07	mr1521_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912370	NA	2.95E-06	mr1555_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912370	NA	6.53E-06	mr1555_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912370	NA	2.03E-08	mr1570_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912370	NA	9.68E-06	mr1591_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912370	NA	2.06E-06	mr1596_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912370	NA	7.74E-06	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912370	NA	8.02E-06	mr1638_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912370	NA	4.39E-06	mr1693_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912370	NA	2.73E-12	mr1713_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912370	NA	9.34E-06	mr1736_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912370	NA	3.16E-06	mr1741_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912370	NA	2.58E-07	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912370	NA	1.46E-07	mr1788_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912370	NA	5.56E-06	mr1813_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912370	NA	4.48E-07	mr1865_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912370	NA	4.40E-10	mr1880_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419912370	NA	2.71E-06	mr1902_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251