\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0419905874:

Variant ID: vg0419905874 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 19905874
Reference Allele: CAlternative Allele: A,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCCCATTTGCCGTCCAATTGCAGTGAGCAGGGGCGGATTCAGGAAAAAAAAATAGGGGCTCAGTTACACAGTTTCTTCAATCTACAACTATTTAAGGAC[C/A,T]
TTTAGTTTATCATTCATGGTGAAAAATCGAAGGGGTTGTTCCGGGGGTATCCATGGGTCTTGTGGGTGTAGAGGGGACTTGAGTTCCCCTGCACCCACAT

Reverse complement sequence

ATGTGGGTGCAGGGGAACTCAAGTCCCCTCTACACCCACAAGACCCATGGATACCCCCGGAACAACCCCTTCGATTTTTCACCATGAATGATAAACTAAA[G/T,A]
GTCCTTAAATAGTTGTAGATTGAAGAAACTGTGTAACTGAGCCCCTATTTTTTTTTCCTGAATCCGCCCCTGCTCACTGCAATTGGACGGCAAATGGGCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.10% 9.00% 13.52% 5.27% T: 0.04%
All Indica  2759 68.80% 1.50% 21.42% 8.26% NA
All Japonica  1512 78.40% 21.30% 0.26% 0.07% NA
Aus  269 71.00% 7.80% 13.38% 7.06% T: 0.74%
Indica I  595 47.60% 0.70% 36.30% 15.46% NA
Indica II  465 67.10% 0.20% 24.95% 7.74% NA
Indica III  913 81.70% 1.60% 11.94% 4.71% NA
Indica Intermediate  786 70.90% 2.80% 19.08% 7.25% NA
Temperate Japonica  767 81.90% 18.00% 0.00% 0.13% NA
Tropical Japonica  504 65.30% 34.30% 0.40% 0.00% NA
Japonica Intermediate  241 94.60% 4.60% 0.83% 0.00% NA
VI/Aromatic  96 64.60% 34.40% 1.04% 0.00% NA
Intermediate  90 81.10% 10.00% 7.78% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0419905874 C -> DEL N N silent_mutation Average:56.271; most accessible tissue: Minghui63 root, score: 73.351 N N N N
vg0419905874 C -> A LOC_Os04g32940.1 upstream_gene_variant ; 2217.0bp to feature; MODIFIER silent_mutation Average:56.271; most accessible tissue: Minghui63 root, score: 73.351 N N N N
vg0419905874 C -> A LOC_Os04g32940-LOC_Os04g32950 intergenic_region ; MODIFIER silent_mutation Average:56.271; most accessible tissue: Minghui63 root, score: 73.351 N N N N
vg0419905874 C -> T LOC_Os04g32940.1 upstream_gene_variant ; 2217.0bp to feature; MODIFIER silent_mutation Average:56.271; most accessible tissue: Minghui63 root, score: 73.351 N N N N
vg0419905874 C -> T LOC_Os04g32940-LOC_Os04g32950 intergenic_region ; MODIFIER silent_mutation Average:56.271; most accessible tissue: Minghui63 root, score: 73.351 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0419905874 2.60E-06 2.60E-06 mr1076_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419905874 2.98E-07 NA mr1082_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419905874 NA 9.05E-07 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419905874 5.47E-08 NA mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419905874 NA 2.71E-07 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419905874 8.63E-06 NA mr1085_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419905874 NA 6.00E-06 mr1085_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419905874 3.31E-06 NA mr1103_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419905874 4.40E-06 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419905874 2.61E-09 NA mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419905874 6.81E-06 9.11E-07 mr1107_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419905874 1.47E-06 1.47E-06 mr1145_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419905874 6.67E-09 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419905874 NA 9.39E-07 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419905874 7.15E-09 4.22E-12 mr1408_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419905874 1.42E-06 2.39E-09 mr1408_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419905874 NA 5.30E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251