Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0419905874:

Variant ID: vg0419905874 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 19905874
Reference Allele: C	Alternative Allele: A,T
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGCCCATTTGCCGTCCAATTGCAGTGAGCAGGGGCGGATTCAGGAAAAAAAAATAGGGGCTCAGTTACACAGTTTCTTCAATCTACAACTATTTAAGGAC[C/A,T]
TTTAGTTTATCATTCATGGTGAAAAATCGAAGGGGTTGTTCCGGGGGTATCCATGGGTCTTGTGGGTGTAGAGGGGACTTGAGTTCCCCTGCACCCACAT

Reverse complement sequence

ATGTGGGTGCAGGGGAACTCAAGTCCCCTCTACACCCACAAGACCCATGGATACCCCCGGAACAACCCCTTCGATTTTTCACCATGAATGATAAACTAAA[G/T,A]
GTCCTTAAATAGTTGTAGATTGAAGAAACTGTGTAACTGAGCCCCTATTTTTTTTTCCTGAATCCGCCCCTGCTCACTGCAATTGGACGGCAAATGGGCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.10%	9.00%	13.52%	5.27%	T: 0.04%
All Indica	2759	68.80%	1.50%	21.42%	8.26%	NA
All Japonica	1512	78.40%	21.30%	0.26%	0.07%	NA
Aus	269	71.00%	7.80%	13.38%	7.06%	T: 0.74%
Indica I	595	47.60%	0.70%	36.30%	15.46%	NA
Indica II	465	67.10%	0.20%	24.95%	7.74%	NA
Indica III	913	81.70%	1.60%	11.94%	4.71%	NA
Indica Intermediate	786	70.90%	2.80%	19.08%	7.25%	NA
Temperate Japonica	767	81.90%	18.00%	0.00%	0.13%	NA
Tropical Japonica	504	65.30%	34.30%	0.40%	0.00%	NA
Japonica Intermediate	241	94.60%	4.60%	0.83%	0.00%	NA
VI/Aromatic	96	64.60%	34.40%	1.04%	0.00%	NA
Intermediate	90	81.10%	10.00%	7.78%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0419905874	C -> DEL	N	N	silent_mutation	Average:56.271; most accessible tissue: Minghui63 root, score: 73.351	N	N	N	N
vg0419905874	C -> A	LOC_Os04g32940.1	upstream_gene_variant ; 2217.0bp to feature; MODIFIER	silent_mutation	Average:56.271; most accessible tissue: Minghui63 root, score: 73.351	N	N	N	N
vg0419905874	C -> A	LOC_Os04g32940-LOC_Os04g32950	intergenic_region ; MODIFIER	silent_mutation	Average:56.271; most accessible tissue: Minghui63 root, score: 73.351	N	N	N	N
vg0419905874	C -> T	LOC_Os04g32940.1	upstream_gene_variant ; 2217.0bp to feature; MODIFIER	silent_mutation	Average:56.271; most accessible tissue: Minghui63 root, score: 73.351	N	N	N	N
vg0419905874	C -> T	LOC_Os04g32940-LOC_Os04g32950	intergenic_region ; MODIFIER	silent_mutation	Average:56.271; most accessible tissue: Minghui63 root, score: 73.351	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0419905874	2.60E-06	2.60E-06	mr1076_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419905874	2.98E-07	NA	mr1082_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419905874	NA	9.05E-07	mr1082_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419905874	5.47E-08	NA	mr1083_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419905874	NA	2.71E-07	mr1083_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419905874	8.63E-06	NA	mr1085_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419905874	NA	6.00E-06	mr1085_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419905874	3.31E-06	NA	mr1103_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419905874	4.40E-06	NA	mr1104_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419905874	2.61E-09	NA	mr1107_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419905874	6.81E-06	9.11E-07	mr1107_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419905874	1.47E-06	1.47E-06	mr1145_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419905874	6.67E-09	NA	mr1226_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419905874	NA	9.39E-07	mr1226_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419905874	7.15E-09	4.22E-12	mr1408_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419905874	1.42E-06	2.39E-09	mr1408_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419905874	NA	5.30E-07	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251