\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0419905339:

Variant ID: vg0419905339 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 19905339
Reference Allele: AAlternative Allele: G,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.78, A: 0.16, T: 0.05, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


AAAACTTTTATATACGTATTCTTAGAGGCTAAAAAATAAACTTCGATAAAAAAAAACCCTAAAACCAACTCCAAATTTAATGTCGAAAATTTAAATTTTG[A/G,T]
CTGATAAGCATAAATATAAGCGAAAAGATGAGGCCCTTTGACAAGGTATACTTATTTGAATTTGAAACAAGAACATATATACTCCCTTCGTCCCAAATCG

Reverse complement sequence

CGATTTGGGACGAAGGGAGTATATATGTTCTTGTTTCAAATTCAAATAAGTATACCTTGTCAAAGGGCCTCATCTTTTCGCTTATATTTATGCTTATCAG[T/C,A]
CAAAATTTAAATTTTCGACATTAAATTTGGAGTTGGTTTTAGGGTTTTTTTTTATCGAAGTTTATTTTTTAGCCTCTAAGAATACGTATATAAAAGTTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.70% 32.30% 5.44% 3.03% T: 2.58%
All Indica  2759 75.60% 8.00% 8.48% 4.71% T: 3.19%
All Japonica  1512 22.00% 77.80% 0.13% 0.00% NA
Aus  269 75.50% 9.30% 5.20% 4.46% T: 5.58%
Indica I  595 66.70% 7.20% 19.83% 6.22% NA
Indica II  465 77.40% 11.80% 7.31% 3.01% T: 0.43%
Indica III  913 81.30% 4.70% 2.74% 5.48% T: 5.81%
Indica Intermediate  786 74.70% 10.20% 7.25% 3.69% T: 4.20%
Temperate Japonica  767 18.00% 81.90% 0.13% 0.00% NA
Tropical Japonica  504 35.50% 64.30% 0.20% 0.00% NA
Japonica Intermediate  241 6.60% 93.40% 0.00% 0.00% NA
VI/Aromatic  96 25.00% 54.20% 1.04% 0.00% T: 19.79%
Intermediate  90 35.60% 56.70% 6.67% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0419905339 A -> DEL N N silent_mutation Average:31.994; most accessible tissue: Zhenshan97 flower, score: 47.586 N N N N
vg0419905339 A -> G LOC_Os04g32940.1 upstream_gene_variant ; 1682.0bp to feature; MODIFIER silent_mutation Average:31.994; most accessible tissue: Zhenshan97 flower, score: 47.586 N N N N
vg0419905339 A -> G LOC_Os04g32940-LOC_Os04g32950 intergenic_region ; MODIFIER silent_mutation Average:31.994; most accessible tissue: Zhenshan97 flower, score: 47.586 N N N N
vg0419905339 A -> T LOC_Os04g32940.1 upstream_gene_variant ; 1682.0bp to feature; MODIFIER silent_mutation Average:31.994; most accessible tissue: Zhenshan97 flower, score: 47.586 N N N N
vg0419905339 A -> T LOC_Os04g32940-LOC_Os04g32950 intergenic_region ; MODIFIER silent_mutation Average:31.994; most accessible tissue: Zhenshan97 flower, score: 47.586 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0419905339 1.57E-06 1.57E-06 mr1076_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419905339 8.17E-07 NA mr1082_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419905339 6.69E-06 4.60E-07 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419905339 5.18E-06 NA mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419905339 NA 1.87E-07 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419905339 NA 4.58E-06 mr1085_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419905339 1.65E-07 NA mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419905339 3.38E-06 6.55E-07 mr1107_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419905339 4.71E-07 4.71E-07 mr1145_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419905339 NA 1.05E-06 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419905339 NA 5.18E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419905339 2.58E-07 9.72E-10 mr1408_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419905339 NA 1.00E-07 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419905339 NA 2.86E-13 mr1717_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419905339 NA 7.21E-06 mr1788_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251