\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0419845324:

Variant ID: vg0419845324 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 19845324
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


GCCAATGAAGCGACTGGAAAAGAGACTATTTCCCCTTATCCTTGATGTTCACTAAATAACAGAGGGAGCATGAGTAGATTATCGTAGGTACATTTCTTAA[G/A]
CGGCGCGTTAAATGATGCAATTTTTTTTGCAAAAACTTTCTTTCTATAATATTTTTCTACAAAAATCAAATAAACCCGATCGATCCATGCGATAATTATT

Reverse complement sequence

AATAATTATCGCATGGATCGATCGGGTTTATTTGATTTTTGTAGAAAAATATTATAGAAAGAAAGTTTTTGCAAAAAAAATTGCATCATTTAACGCGCCG[C/T]
TTAAGAAATGTACCTACGATAATCTACTCATGCTCCCTCTGTTATTTAGTGAACATCAAGGATAAGGGGAAATAGTCTCTTTTCCAGTCGCTTCATTGGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.90% 12.60% 15.11% 28.37% NA
All Indica  2759 11.10% 20.00% 24.25% 44.58% NA
All Japonica  1512 99.50% 0.20% 0.13% 0.20% NA
Aus  269 42.80% 12.30% 12.64% 32.34% NA
Indica I  595 8.70% 12.80% 32.61% 45.88% NA
Indica II  465 13.80% 22.60% 23.01% 40.65% NA
Indica III  913 8.20% 26.10% 17.74% 47.97% NA
Indica Intermediate  786 14.80% 17.00% 26.21% 41.98% NA
Temperate Japonica  767 99.70% 0.10% 0.13% 0.00% NA
Tropical Japonica  504 98.80% 0.40% 0.20% 0.60% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 80.20% 5.20% 3.12% 11.46% NA
Intermediate  90 80.00% 2.20% 6.67% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0419845324 G -> DEL N N silent_mutation Average:26.019; most accessible tissue: Callus, score: 70.012 N N N N
vg0419845324 G -> A LOC_Os04g32860.1 upstream_gene_variant ; 1048.0bp to feature; MODIFIER silent_mutation Average:26.019; most accessible tissue: Callus, score: 70.012 N N N N
vg0419845324 G -> A LOC_Os04g32870.1 upstream_gene_variant ; 3794.0bp to feature; MODIFIER silent_mutation Average:26.019; most accessible tissue: Callus, score: 70.012 N N N N
vg0419845324 G -> A LOC_Os04g32860-LOC_Os04g32870 intergenic_region ; MODIFIER silent_mutation Average:26.019; most accessible tissue: Callus, score: 70.012 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0419845324 NA 6.90E-08 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845324 NA 1.56E-08 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845324 NA 1.37E-06 mr1332_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845324 3.88E-06 1.10E-06 mr1371_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845324 NA 9.58E-06 mr1439_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845324 NA 2.50E-07 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845324 NA 6.39E-06 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845324 NA 3.14E-06 mr1655_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845324 NA 1.05E-19 mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845324 2.59E-07 5.29E-09 mr1712_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845324 NA 1.70E-13 mr1717_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845324 NA 9.39E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845324 NA 3.07E-13 mr1770_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845324 NA 7.18E-17 mr1836_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845324 NA 4.12E-10 mr1946_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845324 NA 7.55E-07 mr1946_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845324 NA 4.12E-10 mr1948_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845324 NA 7.55E-07 mr1948_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845324 5.11E-06 7.90E-07 mr1977_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251