Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0419845324:

Variant ID: vg0419845324 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 19845324
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

GCCAATGAAGCGACTGGAAAAGAGACTATTTCCCCTTATCCTTGATGTTCACTAAATAACAGAGGGAGCATGAGTAGATTATCGTAGGTACATTTCTTAA[G/A]
CGGCGCGTTAAATGATGCAATTTTTTTTGCAAAAACTTTCTTTCTATAATATTTTTCTACAAAAATCAAATAAACCCGATCGATCCATGCGATAATTATT

Reverse complement sequence

AATAATTATCGCATGGATCGATCGGGTTTATTTGATTTTTGTAGAAAAATATTATAGAAAGAAAGTTTTTGCAAAAAAAATTGCATCATTTAACGCGCCG[C/T]
TTAAGAAATGTACCTACGATAATCTACTCATGCTCCCTCTGTTATTTAGTGAACATCAAGGATAAGGGGAAATAGTCTCTTTTCCAGTCGCTTCATTGGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	43.90%	12.60%	15.11%	28.37%	NA
All Indica	2759	11.10%	20.00%	24.25%	44.58%	NA
All Japonica	1512	99.50%	0.20%	0.13%	0.20%	NA
Aus	269	42.80%	12.30%	12.64%	32.34%	NA
Indica I	595	8.70%	12.80%	32.61%	45.88%	NA
Indica II	465	13.80%	22.60%	23.01%	40.65%	NA
Indica III	913	8.20%	26.10%	17.74%	47.97%	NA
Indica Intermediate	786	14.80%	17.00%	26.21%	41.98%	NA
Temperate Japonica	767	99.70%	0.10%	0.13%	0.00%	NA
Tropical Japonica	504	98.80%	0.40%	0.20%	0.60%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	80.20%	5.20%	3.12%	11.46%	NA
Intermediate	90	80.00%	2.20%	6.67%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0419845324	G -> DEL	N	N	silent_mutation	Average:26.019; most accessible tissue: Callus, score: 70.012	N	N	N	N
vg0419845324	G -> A	LOC_Os04g32860.1	upstream_gene_variant ; 1048.0bp to feature; MODIFIER	silent_mutation	Average:26.019; most accessible tissue: Callus, score: 70.012	N	N	N	N
vg0419845324	G -> A	LOC_Os04g32870.1	upstream_gene_variant ; 3794.0bp to feature; MODIFIER	silent_mutation	Average:26.019; most accessible tissue: Callus, score: 70.012	N	N	N	N
vg0419845324	G -> A	LOC_Os04g32860-LOC_Os04g32870	intergenic_region ; MODIFIER	silent_mutation	Average:26.019; most accessible tissue: Callus, score: 70.012	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0419845324	NA	6.90E-08	mr1750	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845324	NA	1.56E-08	mr1321_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845324	NA	1.37E-06	mr1332_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845324	3.88E-06	1.10E-06	mr1371_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845324	NA	9.58E-06	mr1439_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845324	NA	2.50E-07	mr1568_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845324	NA	6.39E-06	mr1655_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845324	NA	3.14E-06	mr1655_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845324	NA	1.05E-19	mr1712_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845324	2.59E-07	5.29E-09	mr1712_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845324	NA	1.70E-13	mr1717_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845324	NA	9.39E-07	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845324	NA	3.07E-13	mr1770_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845324	NA	7.18E-17	mr1836_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845324	NA	4.12E-10	mr1946_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845324	NA	7.55E-07	mr1946_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845324	NA	4.12E-10	mr1948_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845324	NA	7.55E-07	mr1948_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419845324	5.11E-06	7.90E-07	mr1977_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251