\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0419832144:

Variant ID: vg0419832144 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 19832144
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTTGGGGTACTACTCAGGTCACTATAACCACTAGGCTACATGCCCTTTCGTACAAAATTTAAAAATTTAAAAGAGAAAAATAAACTAGAAGTAAGATAA[G/A]
CCGGTAAAAAACCCACTTGTCCGTCCCGCTTGCATCCCTAGAAAATTTCAGCACGATCGATCGAATCGTGCTAAAAAGTTTCAGCACGGAGAGCTCGCGA

Reverse complement sequence

TCGCGAGCTCTCCGTGCTGAAACTTTTTAGCACGATTCGATCGATCGTGCTGAAATTTTCTAGGGATGCAAGCGGGACGGACAAGTGGGTTTTTTACCGG[C/T]
TTATCTTACTTCTAGTTTATTTTTCTCTTTTAAATTTTTAAATTTTGTACGAAAGGGCATGTAGCCTAGTGGTTATAGTGACCTGAGTAGTACCCCAAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.60% 7.10% 1.06% 16.23% NA
All Indica  2759 71.40% 1.00% 0.18% 27.47% NA
All Japonica  1512 77.80% 19.20% 2.71% 0.20% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 93.40% 0.00% 0.17% 6.39% NA
Indica II  465 66.90% 2.80% 0.22% 30.11% NA
Indica III  913 61.40% 0.10% 0.11% 38.34% NA
Indica Intermediate  786 68.80% 1.70% 0.25% 29.26% NA
Temperate Japonica  767 95.40% 2.10% 2.48% 0.00% NA
Tropical Japonica  504 51.60% 45.60% 2.18% 0.60% NA
Japonica Intermediate  241 76.80% 18.70% 4.56% 0.00% NA
VI/Aromatic  96 96.90% 0.00% 1.04% 2.08% NA
Intermediate  90 74.40% 17.80% 3.33% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0419832144 G -> DEL N N silent_mutation Average:76.763; most accessible tissue: Minghui63 young leaf, score: 97.49 N N N N
vg0419832144 G -> A LOC_Os04g32840.1 upstream_gene_variant ; 4242.0bp to feature; MODIFIER silent_mutation Average:76.763; most accessible tissue: Minghui63 young leaf, score: 97.49 N N N N
vg0419832144 G -> A LOC_Os04g32850.1 downstream_gene_variant ; 2987.0bp to feature; MODIFIER silent_mutation Average:76.763; most accessible tissue: Minghui63 young leaf, score: 97.49 N N N N
vg0419832144 G -> A LOC_Os04g32850.3 downstream_gene_variant ; 2987.0bp to feature; MODIFIER silent_mutation Average:76.763; most accessible tissue: Minghui63 young leaf, score: 97.49 N N N N
vg0419832144 G -> A LOC_Os04g32850.2 downstream_gene_variant ; 2987.0bp to feature; MODIFIER silent_mutation Average:76.763; most accessible tissue: Minghui63 young leaf, score: 97.49 N N N N
vg0419832144 G -> A LOC_Os04g32840-LOC_Os04g32850 intergenic_region ; MODIFIER silent_mutation Average:76.763; most accessible tissue: Minghui63 young leaf, score: 97.49 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0419832144 G A -0.04 0.01 -0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0419832144 3.54E-06 NA mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419832144 NA 3.21E-14 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419832144 6.93E-06 NA mr1070_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419832144 5.59E-09 NA mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419832144 2.22E-07 NA mr1085_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419832144 3.28E-07 NA mr1103_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419832144 7.82E-11 NA mr1104_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419832144 3.31E-08 NA mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419832144 4.31E-07 NA mr1145_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419832144 NA 9.44E-06 mr1155_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419832144 1.18E-08 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419832144 7.02E-06 NA mr1264_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419832144 2.97E-06 NA mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419832144 NA 3.14E-06 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251