\
| Variant ID: vg0419756923 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 19756923 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.82, T: 0.18, others allele: 0.00, population size: 111. )
ATCCCCTGAACTCCTGAAGCGGAGAGGCGGCCGGCTCGAGCACATCGAGGAGGCGCAAGGGGGCTTCCATCTCCCTCCGCCGGTGTTGCCTCACCATCCC[C/T]
CGTAGGTGGAGCAGTCCGTGTAGATCAAGCCGCTGCCACCCCTCCTCATCGCCCGAAGCAGGTGCCAACGATGTGGATCGAGGGTTCGACGCAAGGCGGC
GCCGCCTTGCGTCGAACCCTCGATCCACATCGTTGGCACCTGCTTCGGGCGATGAGGAGGGGTGGCAGCGGCTTGATCTACACGGACTGCTCCACCTACG[G/A]
GGGATGGTGAGGCAACACCGGCGGAGGGAGATGGAAGCCCCCTTGCGCCTCCTCGATGTGCTCGAGCCGGCCGCCTCTCCGCTTCAGGAGTTCAGGGGAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.00% | 39.80% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 94.20% | 5.70% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 0.50% | 99.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 67.30% | 32.30% | 0.37% | 0.00% | NA |
| Indica I | 595 | 91.60% | 8.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 91.40% | 8.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.60% | 2.30% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 93.80% | 6.00% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.60% | 99.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 34.40% | 65.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 18.90% | 78.90% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0419756923 | C -> T | LOC_Os04g32750.1 | upstream_gene_variant ; 1695.0bp to feature; MODIFIER | silent_mutation | Average:61.172; most accessible tissue: Zhenshan97 panicle, score: 84.374 | N | N | N | N |
| vg0419756923 | C -> T | LOC_Os04g32760.1 | upstream_gene_variant ; 3885.0bp to feature; MODIFIER | silent_mutation | Average:61.172; most accessible tissue: Zhenshan97 panicle, score: 84.374 | N | N | N | N |
| vg0419756923 | C -> T | LOC_Os04g32750-LOC_Os04g32760 | intergenic_region ; MODIFIER | silent_mutation | Average:61.172; most accessible tissue: Zhenshan97 panicle, score: 84.374 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0419756923 | NA | 5.01E-06 | mr1750 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419756923 | NA | 1.34E-15 | mr1040_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419756923 | NA | 2.20E-10 | mr1349_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419756923 | NA | 1.73E-06 | mr1349_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419756923 | NA | 8.42E-20 | mr1362_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419756923 | NA | 7.34E-08 | mr1540_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419756923 | NA | 1.87E-07 | mr1568_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419756923 | NA | 4.77E-20 | mr1581_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419756923 | NA | 7.26E-17 | mr1712_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419756923 | NA | 1.78E-12 | mr1713_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419756923 | NA | 2.69E-13 | mr1717_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419756923 | NA | 5.54E-07 | mr1732_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419756923 | NA | 4.79E-17 | mr1836_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |