\
| Variant ID: vg0419753293 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 19753293 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TCCCACCGGTGCGGTAGTTCACCTACAAAAGAAGATCAAGCTCTTTTAGGTACCTAAACTTGTTTGGGTCCTTGGAGGTTAGAGTCCAAAGCTTTGGGCA[T/C]
CCAAATGGCATTCTTTTTACCACCGAGTATAGGGGAACCCACATATCTAGCAACAATACTACCATCATAAGCCTTCCTAAGCATATAATGAGAATCGAAC
GTTCGATTCTCATTATATGCTTAGGAAGGCTTATGATGGTAGTATTGTTGCTAGATATGTGGGTTCCCCTATACTCGGTGGTAAAAAGAATGCCATTTGG[A/G]
TGCCCAAAGCTTTGGACTCTAACCTCCAAGGACCCAAACAAGTTTAGGTACCTAAAAGAGCTTGATCTTCTTTTGTAGGTGAACTACCGCACCGGTGGGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 41.50% | 7.20% | 2.43% | 48.94% | NA |
| All Indica | 2759 | 7.90% | 8.70% | 2.50% | 80.97% | NA |
| All Japonica | 1512 | 99.70% | 0.00% | 0.07% | 0.26% | NA |
| Aus | 269 | 34.90% | 32.00% | 12.27% | 20.82% | NA |
| Indica I | 595 | 14.30% | 0.00% | 0.67% | 85.04% | NA |
| Indica II | 465 | 7.30% | 7.10% | 1.94% | 83.66% | NA |
| Indica III | 913 | 3.80% | 15.00% | 4.27% | 76.89% | NA |
| Indica Intermediate | 786 | 8.00% | 8.80% | 2.16% | 81.04% | NA |
| Temperate Japonica | 767 | 99.60% | 0.00% | 0.13% | 0.26% | NA |
| Tropical Japonica | 504 | 99.60% | 0.00% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 69.80% | 12.50% | 11.46% | 6.25% | NA |
| Intermediate | 90 | 83.30% | 1.10% | 1.11% | 14.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0419753293 | T -> C | LOC_Os04g32750.1 | intron_variant ; MODIFIER | silent_mutation | Average:5.79; most accessible tissue: Callus, score: 16.05 | N | N | N | N |
| vg0419753293 | T -> DEL | N | N | silent_mutation | Average:5.79; most accessible tissue: Callus, score: 16.05 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0419753293 | 3.80E-06 | 8.00E-08 | mr1587 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419753293 | NA | 1.09E-19 | mr1588 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419753293 | NA | 2.58E-11 | mr1713 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419753293 | NA | 2.77E-07 | mr1321_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419753293 | NA | 1.80E-07 | mr1568_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419753293 | NA | 3.48E-20 | mr1581_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419753293 | NA | 3.05E-24 | mr1588_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419753293 | NA | 2.14E-12 | mr1666_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419753293 | NA | 8.16E-13 | mr1713_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419753293 | NA | 1.24E-12 | mr1717_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419753293 | NA | 1.83E-51 | mr1721_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419753293 | NA | 6.46E-11 | mr1761_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419753293 | NA | 2.89E-14 | mr1938_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |