\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0419735193:

Variant ID: vg0419735193 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 19735193
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.56, T: 0.43, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TCTTTATCTATTTTCTTTTCTTAATCAATCATAATTTTTCTTTGATCATTTTCACATACTTCCTTAATACTCGTACTCATCTTAAAAAAATGCTTACATC[T/G]
AACAGAGGTAGTACTTATTAACATATCTGGACTGTATATTGTTTATACTAACATATTCATTAGACCGTATATTATTTATATAAAACATTTTCCATTAGAC

Reverse complement sequence

GTCTAATGGAAAATGTTTTATATAAATAATATACGGTCTAATGAATATGTTAGTATAAACAATATACAGTCCAGATATGTTAATAAGTACTACCTCTGTT[A/C]
GATGTAAGCATTTTTTTAAGATGAGTACGAGTATTAAGGAAGTATGTGAAAATGATCAAAGAAAAATTATGATTGATTAAGAAAAGAAAATAGATAAAGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.10% 39.80% 0.13% 0.00% NA
All Indica  2759 94.50% 5.40% 0.14% 0.00% NA
All Japonica  1512 0.30% 99.70% 0.00% 0.00% NA
Aus  269 67.70% 32.00% 0.37% 0.00% NA
Indica I  595 91.10% 8.60% 0.34% 0.00% NA
Indica II  465 93.10% 6.90% 0.00% 0.00% NA
Indica III  913 98.00% 2.00% 0.00% 0.00% NA
Indica Intermediate  786 93.60% 6.10% 0.25% 0.00% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 0.40% 99.60% 0.00% 0.00% NA
Japonica Intermediate  241 0.00% 100.00% 0.00% 0.00% NA
VI/Aromatic  96 31.20% 68.80% 0.00% 0.00% NA
Intermediate  90 20.00% 78.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0419735193 T -> G LOC_Os04g32730.1 upstream_gene_variant ; 1369.0bp to feature; MODIFIER silent_mutation Average:52.15; most accessible tissue: Callus, score: 83.475 N N N N
vg0419735193 T -> G LOC_Os04g32740.1 upstream_gene_variant ; 678.0bp to feature; MODIFIER silent_mutation Average:52.15; most accessible tissue: Callus, score: 83.475 N N N N
vg0419735193 T -> G LOC_Os04g32730-LOC_Os04g32740 intergenic_region ; MODIFIER silent_mutation Average:52.15; most accessible tissue: Callus, score: 83.475 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0419735193 NA 1.06E-06 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419735193 NA 6.04E-06 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419735193 NA 2.35E-15 mr1713_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419735193 NA 1.53E-07 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419735193 NA 8.17E-08 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419735193 NA 8.47E-11 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419735193 NA 1.43E-06 mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419735193 NA 1.56E-14 mr1938_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419735193 NA 3.38E-06 mr1982_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251