Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0419735193:

Variant ID: vg0419735193 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 19735193
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.56, T: 0.43, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

TCTTTATCTATTTTCTTTTCTTAATCAATCATAATTTTTCTTTGATCATTTTCACATACTTCCTTAATACTCGTACTCATCTTAAAAAAATGCTTACATC[T/G]
AACAGAGGTAGTACTTATTAACATATCTGGACTGTATATTGTTTATACTAACATATTCATTAGACCGTATATTATTTATATAAAACATTTTCCATTAGAC

Reverse complement sequence

GTCTAATGGAAAATGTTTTATATAAATAATATACGGTCTAATGAATATGTTAGTATAAACAATATACAGTCCAGATATGTTAATAAGTACTACCTCTGTT[A/C]
GATGTAAGCATTTTTTTAAGATGAGTACGAGTATTAAGGAAGTATGTGAAAATGATCAAAGAAAAATTATGATTGATTAAGAAAAGAAAATAGATAAAGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.10%	39.80%	0.13%	0.00%	NA
All Indica	2759	94.50%	5.40%	0.14%	0.00%	NA
All Japonica	1512	0.30%	99.70%	0.00%	0.00%	NA
Aus	269	67.70%	32.00%	0.37%	0.00%	NA
Indica I	595	91.10%	8.60%	0.34%	0.00%	NA
Indica II	465	93.10%	6.90%	0.00%	0.00%	NA
Indica III	913	98.00%	2.00%	0.00%	0.00%	NA
Indica Intermediate	786	93.60%	6.10%	0.25%	0.00%	NA
Temperate Japonica	767	0.40%	99.60%	0.00%	0.00%	NA
Tropical Japonica	504	0.40%	99.60%	0.00%	0.00%	NA
Japonica Intermediate	241	0.00%	100.00%	0.00%	0.00%	NA
VI/Aromatic	96	31.20%	68.80%	0.00%	0.00%	NA
Intermediate	90	20.00%	78.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0419735193	T -> G	LOC_Os04g32730.1	upstream_gene_variant ; 1369.0bp to feature; MODIFIER	silent_mutation	Average:52.15; most accessible tissue: Callus, score: 83.475	N	N	N	N
vg0419735193	T -> G	LOC_Os04g32740.1	upstream_gene_variant ; 678.0bp to feature; MODIFIER	silent_mutation	Average:52.15; most accessible tissue: Callus, score: 83.475	N	N	N	N
vg0419735193	T -> G	LOC_Os04g32730-LOC_Os04g32740	intergenic_region ; MODIFIER	silent_mutation	Average:52.15; most accessible tissue: Callus, score: 83.475	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0419735193	NA	1.06E-06	mr1329_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419735193	NA	6.04E-06	mr1524_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419735193	NA	2.35E-15	mr1713_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419735193	NA	1.53E-07	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419735193	NA	8.17E-08	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419735193	NA	8.47E-11	mr1851_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419735193	NA	1.43E-06	mr1915_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419735193	NA	1.56E-14	mr1938_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419735193	NA	3.38E-06	mr1982_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251