| Variant ID: vg0419735193 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 19735193 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.56, T: 0.43, others allele: 0.00, population size: 103. )
TCTTTATCTATTTTCTTTTCTTAATCAATCATAATTTTTCTTTGATCATTTTCACATACTTCCTTAATACTCGTACTCATCTTAAAAAAATGCTTACATC[T/G]
AACAGAGGTAGTACTTATTAACATATCTGGACTGTATATTGTTTATACTAACATATTCATTAGACCGTATATTATTTATATAAAACATTTTCCATTAGAC
GTCTAATGGAAAATGTTTTATATAAATAATATACGGTCTAATGAATATGTTAGTATAAACAATATACAGTCCAGATATGTTAATAAGTACTACCTCTGTT[A/C]
GATGTAAGCATTTTTTTAAGATGAGTACGAGTATTAAGGAAGTATGTGAAAATGATCAAAGAAAAATTATGATTGATTAAGAAAAGAAAATAGATAAAGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.10% | 39.80% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 94.50% | 5.40% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 0.30% | 99.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 67.70% | 32.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 91.10% | 8.60% | 0.34% | 0.00% | NA |
| Indica II | 465 | 93.10% | 6.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 93.60% | 6.10% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.00% | 100.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 31.20% | 68.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 20.00% | 78.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0419735193 | T -> G | LOC_Os04g32730.1 | upstream_gene_variant ; 1369.0bp to feature; MODIFIER | silent_mutation | Average:52.15; most accessible tissue: Callus, score: 83.475 | N | N | N | N |
| vg0419735193 | T -> G | LOC_Os04g32740.1 | upstream_gene_variant ; 678.0bp to feature; MODIFIER | silent_mutation | Average:52.15; most accessible tissue: Callus, score: 83.475 | N | N | N | N |
| vg0419735193 | T -> G | LOC_Os04g32730-LOC_Os04g32740 | intergenic_region ; MODIFIER | silent_mutation | Average:52.15; most accessible tissue: Callus, score: 83.475 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0419735193 | NA | 1.06E-06 | mr1329_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419735193 | NA | 6.04E-06 | mr1524_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419735193 | NA | 2.35E-15 | mr1713_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419735193 | NA | 1.53E-07 | mr1804_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419735193 | NA | 8.17E-08 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419735193 | NA | 8.47E-11 | mr1851_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419735193 | NA | 1.43E-06 | mr1915_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419735193 | NA | 1.56E-14 | mr1938_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0419735193 | NA | 3.38E-06 | mr1982_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |