Variant ID: vg0419558541 (JBrowse) | Variation Type: SNP |
Chromosome: chr04 | Position: 19558541 |
Reference Allele: C | Alternative Allele: A |
Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTACACCCTATCGCTATCGGCTGGTATCGGCATCGGCTATTATCGGCTATCGGTTGGAACTACTCCATCGGCTTGTTAGCCGATCGGCTATTTTGATCTA[C/A]
TATTTGCATATCTTGTCAGTTGCAGGATCAAACTGACTGGCACGTCCGCATCTCATCAAGATTTAGACCTGCACAGCAGCTAAGCAGATCTCCCAGGCCA
TGGCCTGGGAGATCTGCTTAGCTGCTGTGCAGGTCTAAATCTTGATGAGATGCGGACGTGCCAGTCAGTTTGATCCTGCAACTGACAAGATATGCAAATA[G/T]
TAGATCAAAATAGCCGATCGGCTAACAAGCCGATGGAGTAGTTCCAACCGATAGCCGATAATAGCCGATGCCGATACCAGCCGATAGCGATAGGGTGTAA
Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 96.40% | 3.10% | 0.51% | 0.00% | NA |
All Indica | 2759 | 99.30% | 0.70% | 0.04% | 0.00% | NA |
All Japonica | 1512 | 90.70% | 8.00% | 1.32% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.30% | 0.50% | 0.11% | 0.00% | NA |
Indica Intermediate | 786 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 99.20% | 0.00% | 0.78% | 0.00% | NA |
Tropical Japonica | 504 | 75.60% | 21.80% | 2.58% | 0.00% | NA |
Japonica Intermediate | 241 | 95.00% | 4.60% | 0.41% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 87.80% | 8.90% | 3.33% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0419558541 | C -> A | LOC_Os04g32500-LOC_Os04g32510 | intergenic_region ; MODIFIER | silent_mutation | Average:27.007; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0419558541 | NA | 1.84E-06 | mr1422 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0419558541 | NA | 1.07E-09 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0419558541 | 6.15E-07 | 6.15E-07 | mr1050_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0419558541 | 2.53E-06 | 1.08E-07 | mr1498_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0419558541 | NA | 8.60E-07 | mr1629_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0419558541 | NA | 1.18E-07 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |