Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0419279668:

Variant ID: vg0419279668 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 19279668
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 127. )

Flanking Sequence (100 bp) in Reference Genome:

GGTTTTGGCAACAACCAATATGTATTTTGAACAATCCTCATATAATGTGTTATATATGTATTTTCACTGTCTGTTTCATCCTTAACATATACATCAATGG[C/A]
TAACTATCATATAATATTTCTAAACTATATGAATCATGCATTTTGTTGTTATTATATAATGATACTTTTGATATATTTGCAACTATACTTTATACATAAA

Reverse complement sequence

TTTATGTATAAAGTATAGTTGCAAATATATCAAAAGTATCATTATATAATAACAACAAAATGCATGATTCATATAGTTTAGAAATATTATATGATAGTTA[G/T]
CCATTGATGTATATGTTAAGGATGAAACAGACAGTGAAAATACATATATAACACATTATATGAGGATTGTTCAAAATACATATTGGTTGTTGCCAAAACC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.50%	10.90%	0.57%	0.00%	NA
All Indica	2759	98.30%	1.60%	0.18%	0.00%	NA
All Japonica	1512	74.20%	24.70%	1.12%	0.00%	NA
Aus	269	73.20%	26.00%	0.74%	0.00%	NA
Indica I	595	99.30%	0.20%	0.50%	0.00%	NA
Indica II	465	95.70%	4.10%	0.22%	0.00%	NA
Indica III	913	99.20%	0.80%	0.00%	0.00%	NA
Indica Intermediate	786	97.80%	2.00%	0.13%	0.00%	NA
Temperate Japonica	767	97.00%	2.10%	0.91%	0.00%	NA
Tropical Japonica	504	41.30%	57.10%	1.59%	0.00%	NA
Japonica Intermediate	241	70.50%	28.60%	0.83%	0.00%	NA
VI/Aromatic	96	82.30%	16.70%	1.04%	0.00%	NA
Intermediate	90	82.20%	15.60%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0419279668	C -> A	LOC_Os04g32150.1	upstream_gene_variant ; 3631.0bp to feature; MODIFIER	silent_mutation	Average:27.789; most accessible tissue: Callus, score: 52.968	N	N	N	N
vg0419279668	C -> A	LOC_Os04g32130.1	downstream_gene_variant ; 434.0bp to feature; MODIFIER	silent_mutation	Average:27.789; most accessible tissue: Callus, score: 52.968	N	N	N	N
vg0419279668	C -> A	LOC_Os04g32140.1	downstream_gene_variant ; 651.0bp to feature; MODIFIER	silent_mutation	Average:27.789; most accessible tissue: Callus, score: 52.968	N	N	N	N
vg0419279668	C -> A	LOC_Os04g32130-LOC_Os04g32140	intergenic_region ; MODIFIER	silent_mutation	Average:27.789; most accessible tissue: Callus, score: 52.968	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0419279668	NA	2.21E-06	mr1248	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419279668	NA	2.28E-06	mr1295	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419279668	NA	1.18E-20	mr1301	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419279668	NA	1.53E-07	mr1405	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419279668	NA	4.68E-15	mr1410	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419279668	NA	3.27E-15	mr1410	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419279668	NA	1.18E-08	mr1570	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419279668	NA	7.10E-07	mr1676	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419279668	NA	1.68E-19	mr1699	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419279668	NA	1.20E-19	mr1825	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419279668	NA	3.83E-08	mr1851	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419279668	NA	1.59E-07	mr1993	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419279668	2.39E-06	2.08E-12	mr1993	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419279668	3.82E-08	3.14E-22	mr1301_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419279668	NA	2.41E-22	mr1301_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419279668	NA	4.24E-11	mr1398_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419279668	NA	6.41E-06	mr1398_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419279668	4.45E-08	2.15E-18	mr1410_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419279668	NA	1.04E-16	mr1410_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419279668	NA	4.15E-11	mr1533_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419279668	NA	3.03E-14	mr1552_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419279668	NA	2.48E-07	mr1554_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419279668	NA	5.07E-12	mr1593_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419279668	NA	6.73E-07	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419279668	NA	3.27E-18	mr1699_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419279668	NA	3.84E-08	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419279668	1.07E-07	1.28E-12	mr1993_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419279668	NA	4.66E-18	mr1993_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251