\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0419230999:

Variant ID: vg0419230999 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 19230999
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


CAAGATTGCCCTCTTCGTGTTTGCCTCGCTTGTTGGCAGTGATGGTGGTGTCATTGCTGGCCTTGCAGCATGTGGTGTAATCATGTCAATCGTCTGCTCC[A/G]
CAGCGGATCTCATGCAGGACTTCAAGAGCGGCTATCTCACCCTCTCCTCGCCTCGATCGATGTTCATTTCCCAGATGATCGGTGTCGCCCTCGGGTGCAT

Reverse complement sequence

ATGCACCCGAGGGCGACACCGATCATCTGGGAAATGAACATCGATCGAGGCGAGGAGAGGGTGAGATAGCCGCTCTTGAAGTCCTGCATGAGATCCGCTG[T/C]
GGAGCAGACGATTGACATGATTACACCACATGCTGCAAGGCCAGCAATGACACCACCATCACTGCCAACAAGCGAGGCAAACACGAAGAGGGCAATCTTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.90% 46.70% 0.15% 0.28% NA
All Indica  2759 82.70% 16.90% 0.07% 0.36% NA
All Japonica  1512 0.30% 99.50% 0.07% 0.07% NA
Aus  269 71.70% 28.30% 0.00% 0.00% NA
Indica I  595 78.50% 20.80% 0.17% 0.50% NA
Indica II  465 59.10% 40.40% 0.22% 0.22% NA
Indica III  913 98.60% 1.30% 0.00% 0.11% NA
Indica Intermediate  786 81.30% 18.10% 0.00% 0.64% NA
Temperate Japonica  767 0.30% 99.60% 0.13% 0.00% NA
Tropical Japonica  504 0.40% 99.60% 0.00% 0.00% NA
Japonica Intermediate  241 0.40% 99.20% 0.00% 0.41% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 17.80% 75.60% 4.44% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0419230999 A -> DEL LOC_Os04g32060.1 N frameshift_variant Average:76.995; most accessible tissue: Zhenshan97 flower, score: 91.419 N N N N
vg0419230999 A -> DEL LOC_Os04g32060.2 N frameshift_variant Average:76.995; most accessible tissue: Zhenshan97 flower, score: 91.419 N N N N
vg0419230999 A -> G LOC_Os04g32060.2 missense_variant ; p.Thr360Ala; MODERATE nonsynonymous_codon ; T360A Average:76.995; most accessible tissue: Zhenshan97 flower, score: 91.419 benign -0.302 TOLERATED 1.00
vg0419230999 A -> G LOC_Os04g32060.1 missense_variant ; p.Thr230Ala; MODERATE nonsynonymous_codon ; T230A Average:76.995; most accessible tissue: Zhenshan97 flower, score: 91.419 benign -0.302 TOLERATED 1.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0419230999 A G -0.02 -0.02 -0.01 -0.01 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0419230999 NA 1.95E-15 mr1324 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419230999 NA 1.99E-12 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419230999 NA 2.70E-13 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419230999 NA 3.74E-13 mr1335 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419230999 8.24E-06 1.18E-06 mr1405 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419230999 1.99E-07 1.90E-16 mr1521 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419230999 7.37E-07 7.37E-07 mr1521 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419230999 3.63E-18 1.80E-18 mr1851 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419230999 2.27E-16 1.19E-18 mr1851 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419230999 3.03E-19 1.07E-23 mr1864 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419230999 6.67E-19 1.80E-22 mr1864 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419230999 NA 7.41E-22 mr1195_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419230999 NA 1.38E-16 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419230999 6.54E-06 2.36E-06 mr1521_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419230999 1.56E-06 7.13E-11 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0419230999 2.41E-06 NA mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251