\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0418239478:

Variant ID: vg0418239478 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 18239478
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 41. )

Flanking Sequence (100 bp) in Reference Genome:


TCTCTTTTACCTAAGTCTCGCATATATCCTAGTACCAACGATCCCTATACTATGCAAATACCGGAATCGCAACATCAAACATCGACAATAGCCGATGGAT[C/T]
AGTACTTACAGCAAAAGTAGATAATGTACTGGCTAATACTCTAATACAGACTTATATGAACAAATCAATCTATATAAATATATTAGATAGCAATCGATCA

Reverse complement sequence

TGATCGATTGCTATCTAATATATTTATATAGATTGATTTGTTCATATAAGTCTGTATTAGAGTATTAGCCAGTACATTATCTACTTTTGCTGTAAGTACT[G/A]
ATCCATCGGCTATTGTCGATGTTTGATGTTGCGATTCCGGTATTTGCATAGTATAGGGATCGTTGGTACTAGGATATATGCGAGACTTAGGTAAAAGAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.10% 1.80% 0.99% 13.18% NA
All Indica  2759 94.30% 3.00% 1.49% 1.20% NA
All Japonica  1512 61.80% 0.00% 0.33% 37.83% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 85.00% 9.10% 5.38% 0.50% NA
Indica II  465 94.20% 1.50% 0.00% 4.30% NA
Indica III  913 99.70% 0.00% 0.11% 0.22% NA
Indica Intermediate  786 95.20% 2.80% 1.02% 1.02% NA
Temperate Japonica  767 91.10% 0.00% 0.00% 8.87% NA
Tropical Japonica  504 31.20% 0.00% 0.60% 68.25% NA
Japonica Intermediate  241 32.80% 0.00% 0.83% 66.39% NA
VI/Aromatic  96 93.80% 0.00% 0.00% 6.25% NA
Intermediate  90 85.60% 0.00% 1.11% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0418239478 C -> DEL N N silent_mutation Average:40.202; most accessible tissue: Zhenshan97 young leaf, score: 55.261 N N N N
vg0418239478 C -> T LOC_Os04g30520.1 downstream_gene_variant ; 1450.0bp to feature; MODIFIER silent_mutation Average:40.202; most accessible tissue: Zhenshan97 young leaf, score: 55.261 N N N N
vg0418239478 C -> T LOC_Os04g30520-LOC_Os04g30530 intergenic_region ; MODIFIER silent_mutation Average:40.202; most accessible tissue: Zhenshan97 young leaf, score: 55.261 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0418239478 NA 6.58E-07 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418239478 NA 1.07E-08 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418239478 NA 6.07E-13 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418239478 NA 5.97E-12 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418239478 NA 8.39E-06 mr1851_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418239478 1.50E-06 2.00E-10 mr1864_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251