Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0418239478:

Variant ID: vg0418239478 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 18239478
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 41. )

Flanking Sequence (100 bp) in Reference Genome:

TCTCTTTTACCTAAGTCTCGCATATATCCTAGTACCAACGATCCCTATACTATGCAAATACCGGAATCGCAACATCAAACATCGACAATAGCCGATGGAT[C/T]
AGTACTTACAGCAAAAGTAGATAATGTACTGGCTAATACTCTAATACAGACTTATATGAACAAATCAATCTATATAAATATATTAGATAGCAATCGATCA

Reverse complement sequence

TGATCGATTGCTATCTAATATATTTATATAGATTGATTTGTTCATATAAGTCTGTATTAGAGTATTAGCCAGTACATTATCTACTTTTGCTGTAAGTACT[G/A]
ATCCATCGGCTATTGTCGATGTTTGATGTTGCGATTCCGGTATTTGCATAGTATAGGGATCGTTGGTACTAGGATATATGCGAGACTTAGGTAAAAGAGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.10%	1.80%	0.99%	13.18%	NA
All Indica	2759	94.30%	3.00%	1.49%	1.20%	NA
All Japonica	1512	61.80%	0.00%	0.33%	37.83%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	85.00%	9.10%	5.38%	0.50%	NA
Indica II	465	94.20%	1.50%	0.00%	4.30%	NA
Indica III	913	99.70%	0.00%	0.11%	0.22%	NA
Indica Intermediate	786	95.20%	2.80%	1.02%	1.02%	NA
Temperate Japonica	767	91.10%	0.00%	0.00%	8.87%	NA
Tropical Japonica	504	31.20%	0.00%	0.60%	68.25%	NA
Japonica Intermediate	241	32.80%	0.00%	0.83%	66.39%	NA
VI/Aromatic	96	93.80%	0.00%	0.00%	6.25%	NA
Intermediate	90	85.60%	0.00%	1.11%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0418239478	C -> DEL	N	N	silent_mutation	Average:40.202; most accessible tissue: Zhenshan97 young leaf, score: 55.261	N	N	N	N
vg0418239478	C -> T	LOC_Os04g30520.1	downstream_gene_variant ; 1450.0bp to feature; MODIFIER	silent_mutation	Average:40.202; most accessible tissue: Zhenshan97 young leaf, score: 55.261	N	N	N	N
vg0418239478	C -> T	LOC_Os04g30520-LOC_Os04g30530	intergenic_region ; MODIFIER	silent_mutation	Average:40.202; most accessible tissue: Zhenshan97 young leaf, score: 55.261	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0418239478	NA	6.58E-07	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418239478	NA	1.07E-08	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418239478	NA	6.07E-13	mr1038_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418239478	NA	5.97E-12	mr1389_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418239478	NA	8.39E-06	mr1851_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418239478	1.50E-06	2.00E-10	mr1864_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251