\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0418086846:

Variant ID: vg0418086846 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 18086846
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, T: 0.02, others allele: 0.00, population size: 45. )

Flanking Sequence (100 bp) in Reference Genome:


GCAAGCCTGCGCAGCGGGGGCCGGCCTGTCAAGCTCACTGGTCGTGCCTCGTCCTCCCGTGCTCGTGGAAGCGGCAGCTGGCGCTGGACTGGCGTGAGGA[A/T]
GATGGAAAGCGGCAGCCCCAATCGGACTTCCACGGGTAGATGGGCGATGGTCGGGGGAGAGAGGCGGGCGGCGCTGGCTTGATCTTCTTCATCTTGAGCA

Reverse complement sequence

TGCTCAAGATGAAGAAGATCAAGCCAGCGCCGCCCGCCTCTCTCCCCCGACCATCGCCCATCTACCCGTGGAAGTCCGATTGGGGCTGCCGCTTTCCATC[T/A]
TCCTCACGCCAGTCCAGCGCCAGCTGCCGCTTCCACGAGCACGGGAGGACGAGGCACGACCAGTGAGCTTGACAGGCCGGCCCCCGCTGCGCAGGCTTGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.60% 41.10% 0.80% 12.51% NA
All Indica  2759 66.10% 23.70% 0.69% 9.53% NA
All Japonica  1512 12.50% 67.10% 0.53% 19.91% NA
Aus  269 41.60% 52.40% 2.23% 3.72% NA
Indica I  595 57.60% 41.70% 0.67% 0.00% NA
Indica II  465 50.80% 42.20% 0.65% 6.45% NA
Indica III  913 77.40% 2.50% 0.44% 19.61% NA
Indica Intermediate  786 68.40% 23.70% 1.02% 6.87% NA
Temperate Japonica  767 3.00% 97.00% 0.00% 0.00% NA
Tropical Japonica  504 18.10% 33.50% 0.99% 47.42% NA
Japonica Intermediate  241 31.10% 41.90% 1.24% 25.73% NA
VI/Aromatic  96 10.40% 76.00% 4.17% 9.38% NA
Intermediate  90 23.30% 66.70% 1.11% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0418086846 A -> DEL LOC_Os04g30290.1 N frameshift_variant Average:82.785; most accessible tissue: Minghui63 flag leaf, score: 97.221 N N N N
vg0418086846 A -> T LOC_Os04g30290.1 missense_variant ; p.Glu80Asp; MODERATE nonsynonymous_codon ; E80D Average:82.785; most accessible tissue: Minghui63 flag leaf, score: 97.221 unknown unknown DELETERIOUS 0.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0418086846 A T 0.03 0.01 0.0 0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0418086846 NA 4.85E-06 mr1104 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418086846 NA 3.55E-08 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418086846 NA 1.77E-14 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418086846 NA 4.06E-12 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418086846 NA 7.19E-08 mr1851 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418086846 NA 5.39E-06 mr1864 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418086846 NA 3.15E-06 mr1221_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418086846 1.73E-06 5.43E-08 mr1228_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418086846 NA 6.12E-16 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418086846 NA 6.53E-06 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418086846 NA 6.15E-13 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418086846 NA 1.25E-11 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418086846 NA 5.02E-07 mr1554_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418086846 NA 2.25E-08 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418086846 NA 9.01E-09 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418086846 NA 1.61E-06 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418086846 4.28E-06 4.27E-06 mr1869_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418086846 NA 2.99E-06 mr1873_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418086846 NA 7.78E-07 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418086846 NA 5.99E-11 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418086846 NA 3.82E-06 mr1944_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251