| Variant ID: vg0417993690 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 17993690 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TATTAAACAAATATTAAATTTAGATCCTTTAAATGCCCCTAAAATCATCACGTGGCAATCATACCAATGCCCCTAAACCGACATGTAATTATAATCACGT[T/G]
TAATTATGATCACGTGTAAAATTCACAGAAATTATATTAAAAAAATCTAACCACCGCTTTTCCAATATTTTCAATCATTAGATCTAATCTTAATCTTAAC
GTTAAGATTAAGATTAGATCTAATGATTGAAAATATTGGAAAAGCGGTGGTTAGATTTTTTTAATATAATTTCTGTGAATTTTACACGTGATCATAATTA[A/C]
ACGTGATTATAATTACATGTCGGTTTAGGGGCATTGGTATGATTGCCACGTGATGATTTTAGGGGCATTTAAAGGATCTAAATTTAATATTTGTTTAATA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.70% | 0.20% | 1.18% | 41.85% | NA |
| All Indica | 2759 | 55.60% | 0.10% | 1.09% | 43.28% | NA |
| All Japonica | 1512 | 53.10% | 0.10% | 0.99% | 45.83% | NA |
| Aus | 269 | 79.20% | 3.00% | 2.97% | 14.87% | NA |
| Indica I | 595 | 92.40% | 0.00% | 0.00% | 7.56% | NA |
| Indica II | 465 | 32.50% | 0.00% | 0.43% | 67.10% | NA |
| Indica III | 913 | 39.20% | 0.20% | 1.53% | 59.04% | NA |
| Indica Intermediate | 786 | 60.30% | 0.00% | 1.78% | 37.91% | NA |
| Temperate Japonica | 767 | 66.90% | 0.00% | 0.52% | 32.59% | NA |
| Tropical Japonica | 504 | 36.50% | 0.20% | 1.98% | 61.31% | NA |
| Japonica Intermediate | 241 | 44.00% | 0.00% | 0.41% | 55.60% | NA |
| VI/Aromatic | 96 | 80.20% | 0.00% | 2.08% | 17.71% | NA |
| Intermediate | 90 | 61.10% | 0.00% | 1.11% | 37.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0417993690 | T -> DEL | N | N | silent_mutation | Average:6.469; most accessible tissue: Callus, score: 21.236 | N | N | N | N |
| vg0417993690 | T -> G | LOC_Os04g30150.1 | upstream_gene_variant ; 3817.0bp to feature; MODIFIER | silent_mutation | Average:6.469; most accessible tissue: Callus, score: 21.236 | N | N | N | N |
| vg0417993690 | T -> G | LOC_Os04g30150-LOC_Os04g30160 | intergenic_region ; MODIFIER | silent_mutation | Average:6.469; most accessible tissue: Callus, score: 21.236 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0417993690 | NA | 4.57E-06 | mr1397_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417993690 | NA | 1.74E-06 | mr1621_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417993690 | 6.63E-07 | 6.62E-07 | mr1760_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417993690 | NA | 3.08E-06 | mr1966_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |