\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0417918664:

Variant ID: vg0417918664 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 17918664
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, T: 0.11, others allele: 0.00, population size: 54. )

Flanking Sequence (100 bp) in Reference Genome:


AATTTTGGCGTGAACTAAACACACCCAAAATTGAAAGTTTGATTAAAATTGAAACGATGTGACGGAAAAGTTAAAAGTTTGCGTGTGGCCTGGTTTAGTT[T/C]
CCAACTTTTTTTTCAAACTTCCAATTTTTCTATCACATCAAAACTTTCCTACACACATAAACTTCTAACTTTTCCGTCACATCATTCCAATTTCAATCAA

Reverse complement sequence

TTGATTGAAATTGGAATGATGTGACGGAAAAGTTAGAAGTTTATGTGTGTAGGAAAGTTTTGATGTGATAGAAAAATTGGAAGTTTGAAAAAAAAGTTGG[A/G]
AACTAAACCAGGCCACACGCAAACTTTTAACTTTTCCGTCACATCGTTTCAATTTTAATCAAACTTTCAATTTTGGGTGTGTTTAGTTCACGCCAAAATT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.80% 18.20% 3.43% 41.62% NA
All Indica  2759 35.90% 5.20% 2.21% 56.72% NA
All Japonica  1512 25.40% 43.70% 6.22% 24.67% NA
Aus  269 95.20% 3.30% 0.74% 0.74% NA
Indica I  595 67.10% 14.30% 7.39% 11.26% NA
Indica II  465 12.70% 5.40% 0.65% 81.29% NA
Indica III  913 26.50% 1.00% 0.77% 71.74% NA
Indica Intermediate  786 36.90% 3.10% 0.89% 59.16% NA
Temperate Japonica  767 24.80% 18.60% 11.08% 45.50% NA
Tropical Japonica  504 27.80% 71.00% 0.20% 0.99% NA
Japonica Intermediate  241 22.40% 66.40% 3.32% 7.88% NA
VI/Aromatic  96 75.00% 24.00% 1.04% 0.00% NA
Intermediate  90 38.90% 26.70% 4.44% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0417918664 T -> C LOC_Os04g30030.1 upstream_gene_variant ; 1886.0bp to feature; MODIFIER silent_mutation Average:11.042; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0417918664 T -> C LOC_Os04g30030-LOC_Os04g30040 intergenic_region ; MODIFIER silent_mutation Average:11.042; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0417918664 T -> DEL N N silent_mutation Average:11.042; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0417918664 NA 9.65E-06 mr1028 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417918664 NA 2.43E-06 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417918664 NA 3.20E-06 mr1045_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417918664 NA 1.01E-06 mr1051_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417918664 NA 3.85E-08 mr1169_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417918664 3.54E-06 3.54E-06 mr1169_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417918664 NA 1.83E-07 mr1510_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417918664 1.31E-06 1.30E-06 mr1569_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417918664 NA 4.27E-06 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417918664 NA 3.05E-07 mr1702_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417918664 NA 3.49E-08 mr1702_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417918664 NA 4.33E-06 mr1729_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417918664 NA 1.84E-06 mr1735_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417918664 7.62E-06 NA mr1757_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417918664 NA 2.69E-07 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417918664 NA 6.68E-06 mr1788_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417918664 NA 2.89E-06 mr1986_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251