Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0417792314:

Variant ID: vg0417792314 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 17792314
Reference Allele: C	Alternative Allele: T,G
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

TAATAGTAGTGGATTTTCTATTGGGTCTTTTTTTTACAGTGGTTAATGGGCCTTTTAAAGTGGTATGCATTAAATTTACCAAAAAAGTGATATCTTTACT[C/T,G]
GTATATATATACTTCCTAGCAATCCAAAAATTCCCCATCTCTACTCCCAGGCGCCGTCACACCAAAAATTCTGTGTCGCGCGTGCTCGTTCTACTCCCGT

Reverse complement sequence

ACGGGAGTAGAACGAGCACGCGCGACACAGAATTTTTGGTGTGACGGCGCCTGGGAGTAGAGATGGGGAATTTTTGGATTGCTAGGAAGTATATATATAC[G/A,C]
AGTAAAGATATCACTTTTTTGGTAAATTTAATGCATACCACTTTAAAAGGCCCATTAACCACTGTAAAAAAAAGACCCAATAGAAAATCCACTACTATTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.50%	1.90%	2.39%	27.19%	G: 0.02%
All Indica	2759	50.00%	3.20%	3.84%	42.91%	NA
All Japonica	1512	99.50%	0.00%	0.26%	0.13%	G: 0.07%
Aus	269	66.90%	0.00%	0.74%	32.34%	NA
Indica I	595	84.20%	9.90%	4.37%	1.51%	NA
Indica II	465	51.60%	1.50%	4.30%	42.58%	NA
Indica III	913	27.60%	0.00%	2.30%	70.10%	NA
Indica Intermediate	786	49.20%	2.90%	4.96%	42.88%	NA
Temperate Japonica	767	99.50%	0.00%	0.52%	0.00%	NA
Tropical Japonica	504	99.40%	0.00%	0.00%	0.40%	G: 0.20%
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	0.00%	0.00%	3.12%	NA
Intermediate	90	88.90%	0.00%	1.11%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0417792314	C -> DEL	N	N	silent_mutation	Average:37.244; most accessible tissue: Zhenshan97 flower, score: 63.813	N	N	N	N
vg0417792314	C -> G	LOC_Os04g29840.1	upstream_gene_variant ; 707.0bp to feature; MODIFIER	silent_mutation	Average:37.244; most accessible tissue: Zhenshan97 flower, score: 63.813	N	N	N	N
vg0417792314	C -> G	LOC_Os04g29850.1	upstream_gene_variant ; 3218.0bp to feature; MODIFIER	silent_mutation	Average:37.244; most accessible tissue: Zhenshan97 flower, score: 63.813	N	N	N	N
vg0417792314	C -> G	LOC_Os04g29840-LOC_Os04g29850	intergenic_region ; MODIFIER	silent_mutation	Average:37.244; most accessible tissue: Zhenshan97 flower, score: 63.813	N	N	N	N
vg0417792314	C -> T	LOC_Os04g29840.1	upstream_gene_variant ; 707.0bp to feature; MODIFIER	silent_mutation	Average:37.244; most accessible tissue: Zhenshan97 flower, score: 63.813	N	N	N	N
vg0417792314	C -> T	LOC_Os04g29850.1	upstream_gene_variant ; 3218.0bp to feature; MODIFIER	silent_mutation	Average:37.244; most accessible tissue: Zhenshan97 flower, score: 63.813	N	N	N	N
vg0417792314	C -> T	LOC_Os04g29840-LOC_Os04g29850	intergenic_region ; MODIFIER	silent_mutation	Average:37.244; most accessible tissue: Zhenshan97 flower, score: 63.813	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0417792314	3.37E-06	1.94E-11	mr1038	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417792314	NA	1.54E-10	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417792314	1.16E-07	2.00E-14	mr1389	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417792314	1.03E-06	5.66E-12	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417792314	1.53E-11	5.37E-20	mr1038_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417792314	5.00E-10	4.26E-17	mr1038_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417792314	1.43E-06	NA	mr1141_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417792314	5.94E-06	NA	mr1141_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417792314	NA	8.17E-06	mr1358_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417792314	3.23E-11	1.28E-18	mr1389_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417792314	4.16E-10	1.69E-16	mr1389_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417792314	NA	2.71E-06	mr1521_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417792314	NA	1.51E-09	mr1864_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251