\
| Variant ID: vg0417689977 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 17689977 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ACTTGCGTTTCTTGTATTCTTCGGTAGCCTCTTTTCTGGCATCCTCAAGTAGAAGTGCCTTATTGATCATATGTTGAAAAGTGGGGAAGTCATGAGCAAG[C/T]
AACTGGAGTCTCATTCCAACTGCGATTCCCTTCAAGAACTTCTTGATCTTCTTCTTGTCTGTGTCCACTTCCTCAGGGGCATACCGAGCCAATTTGTTGA
TCAACAAATTGGCTCGGTATGCCCCTGAGGAAGTGGACACAGACAAGAAGAAGATCAAGAAGTTCTTGAAGGGAATCGCAGTTGGAATGAGACTCCAGTT[G/A]
CTTGCTCATGACTTCCCCACTTTTCAACATATGATCAATAAGGCACTTCTACTTGAGGATGCCAGAAAAGAGGCTACCGAAGAATACAAGAAACGCAAGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.20% | 7.10% | 23.70% | 5.06% | NA |
| All Indica | 2759 | 53.20% | 11.90% | 27.55% | 7.39% | NA |
| All Japonica | 1512 | 81.90% | 0.10% | 15.87% | 2.12% | NA |
| Aus | 269 | 59.90% | 0.70% | 39.03% | 0.37% | NA |
| Indica I | 595 | 77.50% | 2.90% | 17.65% | 2.02% | NA |
| Indica II | 465 | 51.20% | 18.90% | 22.15% | 7.74% | NA |
| Indica III | 913 | 39.30% | 14.00% | 36.14% | 10.51% | NA |
| Indica Intermediate | 786 | 52.20% | 12.00% | 28.24% | 7.63% | NA |
| Temperate Japonica | 767 | 68.60% | 0.10% | 27.90% | 3.39% | NA |
| Tropical Japonica | 504 | 99.40% | 0.00% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 87.60% | 0.40% | 9.54% | 2.49% | NA |
| VI/Aromatic | 96 | 95.80% | 0.00% | 4.17% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 3.30% | 12.22% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0417689977 | C -> DEL | LOC_Os04g29700.1 | N | frameshift_variant | Average:31.293; most accessible tissue: Zhenshan97 flag leaf, score: 58.104 | N | N | N | N |
| vg0417689977 | C -> T | LOC_Os04g29700.1 | synonymous_variant ; p.Leu424Leu; LOW | synonymous_codon | Average:31.293; most accessible tissue: Zhenshan97 flag leaf, score: 58.104 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0417689977 | 1.26E-06 | NA | mr1113_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417689977 | 1.15E-06 | NA | mr1114_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417689977 | 3.11E-07 | NA | mr1117_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417689977 | 1.01E-06 | NA | mr1119_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417689977 | 6.90E-07 | NA | mr1247_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |