\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0417644545:

Variant ID: vg0417644545 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 17644545
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCGGTCCCGGTTAACTCTGCAAGCGTCCGCATGCCGACTGGCAGCCGAGTTCCCCATCTTCGATCTCAAGACTATCACCAACCGAGCCTCAGCGTCGCCG[G/A]
CGCGGGATCCTGTCGCAGGAACAGGGGTCACGACGAGCGATCTGTGCATTCGCCTCCCGAACGACACAGGGAGCACCGAGTTGAACGGCCATGCTCCCCA

Reverse complement sequence

TGGGGAGCATGGCCGTTCAACTCGGTGCTCCCTGTGTCGTTCGGGAGGCGAATGCACAGATCGCTCGTCGTGACCCCTGTTCCTGCGACAGGATCCCGCG[C/T]
CGGCGACGCTGAGGCTCGGTTGGTGATAGTCTTGAGATCGAAGATGGGGAACTCGGCTGCCAGTCGGCATGCGGACGCTTGCAGAGTTAACCGGGACCGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.00% 7.40% 2.09% 1.52% NA
All Indica  2759 96.10% 2.10% 1.41% 0.36% NA
All Japonica  1512 80.50% 16.90% 2.58% 0.00% NA
Aus  269 75.50% 0.00% 1.86% 22.68% NA
Indica I  595 90.40% 5.70% 3.87% 0.00% NA
Indica II  465 97.40% 2.20% 0.22% 0.22% NA
Indica III  913 99.10% 0.10% 0.55% 0.22% NA
Indica Intermediate  786 96.10% 1.80% 1.27% 0.89% NA
Temperate Japonica  767 98.30% 0.80% 0.91% 0.00% NA
Tropical Japonica  504 66.50% 30.80% 2.78% 0.00% NA
Japonica Intermediate  241 53.10% 39.40% 7.47% 0.00% NA
VI/Aromatic  96 47.90% 34.40% 16.67% 1.04% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0417644545 G -> DEL N N silent_mutation Average:47.12; most accessible tissue: Minghui63 young leaf, score: 68.745 N N N N
vg0417644545 G -> A LOC_Os04g29650.1 upstream_gene_variant ; 362.0bp to feature; MODIFIER silent_mutation Average:47.12; most accessible tissue: Minghui63 young leaf, score: 68.745 N N N N
vg0417644545 G -> A LOC_Os04g29640.1 downstream_gene_variant ; 440.0bp to feature; MODIFIER silent_mutation Average:47.12; most accessible tissue: Minghui63 young leaf, score: 68.745 N N N N
vg0417644545 G -> A LOC_Os04g29640-LOC_Os04g29650 intergenic_region ; MODIFIER silent_mutation Average:47.12; most accessible tissue: Minghui63 young leaf, score: 68.745 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0417644545 NA 5.84E-07 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417644545 NA 6.02E-09 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417644545 NA 1.41E-09 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417644545 NA 9.21E-11 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417644545 NA 2.01E-07 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417644545 NA 2.08E-08 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417644545 NA 3.59E-11 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417644545 NA 1.02E-10 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417644545 NA 8.68E-06 mr1404 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417644545 NA 1.38E-08 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417644545 NA 7.29E-09 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417644545 NA 9.44E-07 mr1620 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417644545 NA 1.73E-07 mr1878 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417644545 3.44E-06 5.19E-10 mr1949 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417644545 NA 8.74E-08 mr1233_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417644545 NA 1.22E-10 mr1246_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417644545 NA 1.27E-09 mr1949_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251