Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0417644545:

Variant ID: vg0417644545 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 17644545
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCGGTCCCGGTTAACTCTGCAAGCGTCCGCATGCCGACTGGCAGCCGAGTTCCCCATCTTCGATCTCAAGACTATCACCAACCGAGCCTCAGCGTCGCCG[G/A]
CGCGGGATCCTGTCGCAGGAACAGGGGTCACGACGAGCGATCTGTGCATTCGCCTCCCGAACGACACAGGGAGCACCGAGTTGAACGGCCATGCTCCCCA

Reverse complement sequence

TGGGGAGCATGGCCGTTCAACTCGGTGCTCCCTGTGTCGTTCGGGAGGCGAATGCACAGATCGCTCGTCGTGACCCCTGTTCCTGCGACAGGATCCCGCG[C/T]
CGGCGACGCTGAGGCTCGGTTGGTGATAGTCTTGAGATCGAAGATGGGGAACTCGGCTGCCAGTCGGCATGCGGACGCTTGCAGAGTTAACCGGGACCGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.00%	7.40%	2.09%	1.52%	NA
All Indica	2759	96.10%	2.10%	1.41%	0.36%	NA
All Japonica	1512	80.50%	16.90%	2.58%	0.00%	NA
Aus	269	75.50%	0.00%	1.86%	22.68%	NA
Indica I	595	90.40%	5.70%	3.87%	0.00%	NA
Indica II	465	97.40%	2.20%	0.22%	0.22%	NA
Indica III	913	99.10%	0.10%	0.55%	0.22%	NA
Indica Intermediate	786	96.10%	1.80%	1.27%	0.89%	NA
Temperate Japonica	767	98.30%	0.80%	0.91%	0.00%	NA
Tropical Japonica	504	66.50%	30.80%	2.78%	0.00%	NA
Japonica Intermediate	241	53.10%	39.40%	7.47%	0.00%	NA
VI/Aromatic	96	47.90%	34.40%	16.67%	1.04%	NA
Intermediate	90	96.70%	3.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0417644545	G -> DEL	N	N	silent_mutation	Average:47.12; most accessible tissue: Minghui63 young leaf, score: 68.745	N	N	N	N
vg0417644545	G -> A	LOC_Os04g29650.1	upstream_gene_variant ; 362.0bp to feature; MODIFIER	silent_mutation	Average:47.12; most accessible tissue: Minghui63 young leaf, score: 68.745	N	N	N	N
vg0417644545	G -> A	LOC_Os04g29640.1	downstream_gene_variant ; 440.0bp to feature; MODIFIER	silent_mutation	Average:47.12; most accessible tissue: Minghui63 young leaf, score: 68.745	N	N	N	N
vg0417644545	G -> A	LOC_Os04g29640-LOC_Os04g29650	intergenic_region ; MODIFIER	silent_mutation	Average:47.12; most accessible tissue: Minghui63 young leaf, score: 68.745	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0417644545	NA	5.84E-07	mr1082	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417644545	NA	6.02E-09	mr1086	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417644545	NA	1.41E-09	mr1088	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417644545	NA	9.21E-11	mr1103	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417644545	NA	2.01E-07	mr1104	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417644545	NA	2.08E-08	mr1107	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417644545	NA	3.59E-11	mr1226	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417644545	NA	1.02E-10	mr1246	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417644545	NA	8.68E-06	mr1404	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417644545	NA	1.38E-08	mr1411	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417644545	NA	7.29E-09	mr1560	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417644545	NA	9.44E-07	mr1620	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417644545	NA	1.73E-07	mr1878	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417644545	3.44E-06	5.19E-10	mr1949	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417644545	NA	8.74E-08	mr1233_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417644545	NA	1.22E-10	mr1246_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417644545	NA	1.27E-09	mr1949_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251