Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0417642687:

Variant ID: vg0417642687 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 17642687
Reference Allele: C	Alternative Allele: A,G
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:

AGGTTGTAATTGGTTGATAGGTGAAGGTAGGTGGGGAAATTGCATGGTGCAGAGTTAAAATTAGTTGAGAAAAGAATGTTGGTGGAGAAGTTGGTATATT[C/A,G]
TGAGGTAAATTCTGAGTATTAGAAGTTGTTATGTTTTGAAATGGAGGACTTGTAAATAACAAACCAGGCTGTTCCTAAACACCTAAACCGTTGCATAGAG

Reverse complement sequence

CTCTATGCAACGGTTTAGGTGTTTAGGAACAGCCTGGTTTGTTATTTACAAGTCCTCCATTTCAAAACATAACAACTTCTAATACTCAGAATTTACCTCA[G/T,C]
AATATACCAACTTCTCCACCAACATTCTTTTCTCAACTAATTTTAACTCTGCACCATGCAATTTCCCCACCTACCTTCACCTATCAACCAATTACAACCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.00%	3.50%	10.14%	12.36%	G: 0.04%
All Indica	2759	61.70%	0.80%	16.56%	20.95%	NA
All Japonica	1512	90.30%	8.60%	0.93%	0.13%	NA
Aus	269	98.90%	0.00%	0.37%	0.00%	G: 0.74%
Indica I	595	96.50%	0.00%	2.86%	0.67%	NA
Indica II	465	52.30%	2.60%	23.66%	21.51%	NA
Indica III	913	45.30%	0.30%	17.52%	36.80%	NA
Indica Intermediate	786	60.10%	0.80%	21.63%	17.56%	NA
Temperate Japonica	767	99.10%	0.40%	0.39%	0.13%	NA
Tropical Japonica	504	73.80%	24.00%	1.98%	0.20%	NA
Japonica Intermediate	241	97.10%	2.50%	0.41%	0.00%	NA
VI/Aromatic	96	91.70%	8.30%	0.00%	0.00%	NA
Intermediate	90	80.00%	7.80%	7.78%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0417642687	C -> G	LOC_Os04g29630.1	upstream_gene_variant ; 3706.0bp to feature; MODIFIER	silent_mutation	Average:39.22; most accessible tissue: Zhenshan97 young leaf, score: 78.644	N	N	N	N
vg0417642687	C -> G	LOC_Os04g29640.1	upstream_gene_variant ; 789.0bp to feature; MODIFIER	silent_mutation	Average:39.22; most accessible tissue: Zhenshan97 young leaf, score: 78.644	N	N	N	N
vg0417642687	C -> G	LOC_Os04g29650.1	upstream_gene_variant ; 2220.0bp to feature; MODIFIER	silent_mutation	Average:39.22; most accessible tissue: Zhenshan97 young leaf, score: 78.644	N	N	N	N
vg0417642687	C -> G	LOC_Os04g29630-LOC_Os04g29640	intergenic_region ; MODIFIER	silent_mutation	Average:39.22; most accessible tissue: Zhenshan97 young leaf, score: 78.644	N	N	N	N
vg0417642687	C -> DEL	N	N	silent_mutation	Average:39.22; most accessible tissue: Zhenshan97 young leaf, score: 78.644	N	N	N	N
vg0417642687	C -> A	LOC_Os04g29630.1	upstream_gene_variant ; 3706.0bp to feature; MODIFIER	silent_mutation	Average:39.22; most accessible tissue: Zhenshan97 young leaf, score: 78.644	N	N	N	N
vg0417642687	C -> A	LOC_Os04g29640.1	upstream_gene_variant ; 789.0bp to feature; MODIFIER	silent_mutation	Average:39.22; most accessible tissue: Zhenshan97 young leaf, score: 78.644	N	N	N	N
vg0417642687	C -> A	LOC_Os04g29650.1	upstream_gene_variant ; 2220.0bp to feature; MODIFIER	silent_mutation	Average:39.22; most accessible tissue: Zhenshan97 young leaf, score: 78.644	N	N	N	N
vg0417642687	C -> A	LOC_Os04g29630-LOC_Os04g29640	intergenic_region ; MODIFIER	silent_mutation	Average:39.22; most accessible tissue: Zhenshan97 young leaf, score: 78.644	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0417642687	2.95E-07	3.31E-10	mr1076	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417642687	1.78E-06	3.34E-11	mr1082	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417642687	9.43E-08	2.45E-11	mr1083	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417642687	7.53E-06	7.53E-06	mr1085	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417642687	NA	4.06E-06	mr1086	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417642687	NA	9.59E-07	mr1103	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417642687	3.19E-06	NA	mr1104	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417642687	3.30E-07	3.30E-07	mr1204	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417642687	8.29E-07	3.28E-11	mr1226	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417642687	4.91E-06	1.50E-07	mr1227	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417642687	NA	5.93E-08	mr1408	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417642687	2.14E-09	7.95E-11	mr1411	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417642687	2.20E-06	5.80E-09	mr1560	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417642687	NA	5.87E-07	mr1949	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417642687	3.44E-07	1.05E-10	mr1082_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417642687	9.31E-06	1.24E-08	mr1083_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417642687	NA	8.71E-07	mr1103_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417642687	5.57E-06	4.73E-07	mr1104_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417642687	5.29E-06	5.74E-08	mr1107_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417642687	3.63E-08	3.68E-12	mr1226_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417642687	NA	5.69E-07	mr1408_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251