\
| Variant ID: vg0417556620 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 17556620 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 111. )
TGAAAACCGCCTCTGCATCCATAACCGTCTAAAGGACCCACATGTCCGTGCCTCTGCCAAAAGTGAGGTCGGTTGGAGCCAACCATTGTTCGGCCAAACC[C/T]
TGGTCAAGCCGGCTCGGGTCCCCCTTACACGTGGACGTCCAGGATGAGCTACTTATGACGGTTACGAGGGTAAAATGGATATTGCGCATCAGAGTAACCG
CGGTTACTCTGATGCGCAATATCCATTTTACCCTCGTAACCGTCATAAGTAGCTCATCCTGGACGTCCACGTGTAAGGGGGACCCGAGCCGGCTTGACCA[G/A]
GGTTTGGCCGAACAATGGTTGGCTCCAACCGACCTCACTTTTGGCAGAGGCACGGACATGTGGGTCCTTTAGACGGTTATGGATGCAGAGGCGGTTTTCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.60% | 2.50% | 9.92% | 15.04% | NA |
| All Indica | 2759 | 57.50% | 4.20% | 16.78% | 21.53% | NA |
| All Japonica | 1512 | 99.90% | 0.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 65.40% | 0.00% | 0.00% | 34.57% | NA |
| Indica I | 595 | 82.20% | 9.90% | 6.39% | 1.51% | NA |
| Indica II | 465 | 56.80% | 1.50% | 10.32% | 31.40% | NA |
| Indica III | 913 | 39.80% | 2.30% | 28.92% | 29.03% | NA |
| Indica Intermediate | 786 | 59.90% | 3.60% | 14.38% | 22.14% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 80.20% | 1.00% | 0.00% | 18.75% | NA |
| Intermediate | 90 | 87.80% | 0.00% | 5.56% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0417556620 | C -> DEL | N | N | silent_mutation | Average:30.421; most accessible tissue: Zhenshan97 flag leaf, score: 64.225 | N | N | N | N |
| vg0417556620 | C -> T | LOC_Os04g29550.1 | upstream_gene_variant ; 4026.0bp to feature; MODIFIER | silent_mutation | Average:30.421; most accessible tissue: Zhenshan97 flag leaf, score: 64.225 | N | N | N | N |
| vg0417556620 | C -> T | LOC_Os04g29540.1 | downstream_gene_variant ; 684.0bp to feature; MODIFIER | silent_mutation | Average:30.421; most accessible tissue: Zhenshan97 flag leaf, score: 64.225 | N | N | N | N |
| vg0417556620 | C -> T | LOC_Os04g29540-LOC_Os04g29550 | intergenic_region ; MODIFIER | silent_mutation | Average:30.421; most accessible tissue: Zhenshan97 flag leaf, score: 64.225 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0417556620 | 5.86E-09 | 1.66E-13 | mr1038 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417556620 | 6.29E-11 | 2.17E-15 | mr1389 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417556620 | 4.74E-15 | 1.74E-21 | mr1038_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417556620 | 3.25E-09 | NA | mr1141_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417556620 | 9.04E-15 | 4.26E-20 | mr1389_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417556620 | NA | 9.54E-06 | mr1521_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417556620 | NA | 6.83E-06 | mr1576_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417556620 | NA | 1.45E-08 | mr1864_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |