\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0417524720:

Variant ID: vg0417524720 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 17524720
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAGACGACTTCGCCATGGCAATTTCGCCCCCGCGAGTGCCGAAGAAGCCTTTCCGACCCATCAAGCCTAGGGGCCATAGGGCCGGCGATCGCCCGACGGC[C/A]
CATCAGAGGCCCATGAGCCTCCATAACATTTTGTACCCCTGTAAATATCCCTTTCGTAAGGGCAACCATGTAAATTCCTCTGTATAACCTAAACCATAGT

Reverse complement sequence

ACTATGGTTTAGGTTATACAGAGGAATTTACATGGTTGCCCTTACGAAAGGGATATTTACAGGGGTACAAAATGTTATGGAGGCTCATGGGCCTCTGATG[G/T]
GCCGTCGGGCGATCGCCGGCCCTATGGCCCCTAGGCTTGATGGGTCGGAAAGGCTTCTTCGGCACTCGCGGGGGCGAAATTGCCATGGCGAAGTCGTCTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.00% 1.40% 3.11% 24.48% NA
All Indica  2759 70.00% 0.10% 2.94% 27.04% NA
All Japonica  1512 73.10% 4.10% 1.98% 20.77% NA
Aus  269 62.10% 0.00% 6.69% 31.23% NA
Indica I  595 81.00% 0.00% 1.34% 17.65% NA
Indica II  465 71.40% 0.20% 1.94% 26.45% NA
Indica III  913 59.00% 0.10% 4.38% 36.47% NA
Indica Intermediate  786 73.40% 0.00% 3.05% 23.54% NA
Temperate Japonica  767 59.70% 2.00% 2.87% 35.46% NA
Tropical Japonica  504 95.20% 4.20% 0.00% 0.60% NA
Japonica Intermediate  241 69.70% 10.80% 3.32% 16.18% NA
VI/Aromatic  96 83.30% 0.00% 16.67% 0.00% NA
Intermediate  90 81.10% 2.20% 2.22% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0417524720 C -> DEL LOC_Os04g29469.1 N frameshift_variant Average:27.83; most accessible tissue: Zhenshan97 flag leaf, score: 71.238 N N N N
vg0417524720 C -> A LOC_Os04g29469.1 synonymous_variant ; p.Ala1745Ala; LOW synonymous_codon Average:27.83; most accessible tissue: Zhenshan97 flag leaf, score: 71.238 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0417524720 NA 9.41E-06 mr1040 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417524720 1.26E-06 1.26E-06 mr1085 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417524720 NA 8.10E-06 mr1086 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417524720 NA 8.40E-06 mr1088 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417524720 NA 2.26E-07 mr1104 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417524720 7.20E-07 2.90E-08 mr1155 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417524720 NA 2.09E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417524720 NA 1.50E-08 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417524720 NA 7.94E-06 mr1224 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417524720 NA 2.29E-07 mr1225 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417524720 NA 6.13E-06 mr1404 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417524720 NA 1.51E-11 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417524720 NA 2.27E-06 mr1411 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417524720 NA 5.68E-07 mr1437 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417524720 NA 8.88E-08 mr1746 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417524720 6.00E-07 NA mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417524720 NA 4.41E-12 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417524720 NA 1.43E-07 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251