\
| Variant ID: vg0417365619 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 17365619 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CCTGGAGAAGAACCACATGTCATCTGGATATATCCTGGAGCTCCGCTCAACATTCAGCAGGCATGCACGACATATGGTTAGAAAACATGGAAAAGAATGG[A/G]
CAGTACACGTATCCTAGATATATAATAGCCTCGTATATTCGCTTATTCTTTTTATTAAGAGAACACAGCAAGGGAGGCCCCCGCTGTTTGAATAATTTTA
TAAAATTATTCAAACAGCGGGGGCCTCCCTTGCTGTGTTCTCTTAATAAAAAGAATAAGCGAATATACGAGGCTATTATATATCTAGGATACGTGTACTG[T/C]
CCATTCTTTTCCATGTTTTCTAACCATATGTCGTGCATGCCTGCTGAATGTTGAGCGGAGCTCCAGGATATATCCAGATGACATGTGGTTCTTCTCCAGG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.80% | 1.50% | 0.70% | 0.00% | NA |
| All Indica | 2759 | 99.70% | 0.10% | 0.25% | 0.00% | NA |
| All Japonica | 1512 | 93.80% | 4.60% | 1.52% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.00% | 0.67% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.00% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 96.60% | 2.20% | 1.17% | 0.00% | NA |
| Tropical Japonica | 504 | 92.90% | 5.40% | 1.79% | 0.00% | NA |
| Japonica Intermediate | 241 | 87.10% | 10.80% | 2.07% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 1.10% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0417365619 | A -> G | LOC_Os04g29280.1 | downstream_gene_variant ; 888.0bp to feature; MODIFIER | silent_mutation | Average:57.47; most accessible tissue: Zhenshan97 young leaf, score: 81.353 | N | N | N | N |
| vg0417365619 | A -> G | LOC_Os04g29290.1 | downstream_gene_variant ; 195.0bp to feature; MODIFIER | silent_mutation | Average:57.47; most accessible tissue: Zhenshan97 young leaf, score: 81.353 | N | N | N | N |
| vg0417365619 | A -> G | LOC_Os04g29280-LOC_Os04g29290 | intergenic_region ; MODIFIER | silent_mutation | Average:57.47; most accessible tissue: Zhenshan97 young leaf, score: 81.353 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0417365619 | 4.30E-07 | 4.30E-07 | mr1085 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417365619 | NA | 5.11E-06 | mr1086 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417365619 | NA | 4.90E-07 | mr1104 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417365619 | 2.24E-06 | 8.36E-08 | mr1155 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417365619 | NA | 6.12E-06 | mr1179 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417365619 | NA | 2.11E-09 | mr1213 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417365619 | NA | 6.99E-06 | mr1224 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417365619 | NA | 2.06E-07 | mr1225 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417365619 | 3.07E-06 | NA | mr1226 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417365619 | NA | 1.60E-06 | mr1246 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417365619 | NA | 5.66E-06 | mr1404 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417365619 | NA | 1.04E-11 | mr1410 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417365619 | NA | 1.68E-06 | mr1411 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417365619 | NA | 9.82E-07 | mr1437 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417365619 | NA | 3.70E-06 | mr1596 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417365619 | NA | 9.23E-06 | mr1620 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417365619 | NA | 2.34E-06 | mr1668 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417365619 | 2.68E-06 | 8.50E-06 | mr1104_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417365619 | 2.78E-06 | 1.70E-15 | mr1301_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417365619 | NA | 4.20E-12 | mr1410_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417365619 | 2.66E-06 | NA | mr1993_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |