\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0417365619:

Variant ID: vg0417365619 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 17365619
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCTGGAGAAGAACCACATGTCATCTGGATATATCCTGGAGCTCCGCTCAACATTCAGCAGGCATGCACGACATATGGTTAGAAAACATGGAAAAGAATGG[A/G]
CAGTACACGTATCCTAGATATATAATAGCCTCGTATATTCGCTTATTCTTTTTATTAAGAGAACACAGCAAGGGAGGCCCCCGCTGTTTGAATAATTTTA

Reverse complement sequence

TAAAATTATTCAAACAGCGGGGGCCTCCCTTGCTGTGTTCTCTTAATAAAAAGAATAAGCGAATATACGAGGCTATTATATATCTAGGATACGTGTACTG[T/C]
CCATTCTTTTCCATGTTTTCTAACCATATGTCGTGCATGCCTGCTGAATGTTGAGCGGAGCTCCAGGATATATCCAGATGACATGTGGTTCTTCTCCAGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.80% 1.50% 0.70% 0.00% NA
All Indica  2759 99.70% 0.10% 0.25% 0.00% NA
All Japonica  1512 93.80% 4.60% 1.52% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.30% 0.00% 0.67% 0.00% NA
Indica II  465 99.60% 0.20% 0.22% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.00% 0.25% 0.00% NA
Temperate Japonica  767 96.60% 2.20% 1.17% 0.00% NA
Tropical Japonica  504 92.90% 5.40% 1.79% 0.00% NA
Japonica Intermediate  241 87.10% 10.80% 2.07% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 1.10% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0417365619 A -> G LOC_Os04g29280.1 downstream_gene_variant ; 888.0bp to feature; MODIFIER silent_mutation Average:57.47; most accessible tissue: Zhenshan97 young leaf, score: 81.353 N N N N
vg0417365619 A -> G LOC_Os04g29290.1 downstream_gene_variant ; 195.0bp to feature; MODIFIER silent_mutation Average:57.47; most accessible tissue: Zhenshan97 young leaf, score: 81.353 N N N N
vg0417365619 A -> G LOC_Os04g29280-LOC_Os04g29290 intergenic_region ; MODIFIER silent_mutation Average:57.47; most accessible tissue: Zhenshan97 young leaf, score: 81.353 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0417365619 4.30E-07 4.30E-07 mr1085 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417365619 NA 5.11E-06 mr1086 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417365619 NA 4.90E-07 mr1104 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417365619 2.24E-06 8.36E-08 mr1155 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417365619 NA 6.12E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417365619 NA 2.11E-09 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417365619 NA 6.99E-06 mr1224 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417365619 NA 2.06E-07 mr1225 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417365619 3.07E-06 NA mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417365619 NA 1.60E-06 mr1246 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417365619 NA 5.66E-06 mr1404 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417365619 NA 1.04E-11 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417365619 NA 1.68E-06 mr1411 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417365619 NA 9.82E-07 mr1437 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417365619 NA 3.70E-06 mr1596 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417365619 NA 9.23E-06 mr1620 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417365619 NA 2.34E-06 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417365619 2.68E-06 8.50E-06 mr1104_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417365619 2.78E-06 1.70E-15 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417365619 NA 4.20E-12 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417365619 2.66E-06 NA mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251