\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0417352590:

Variant ID: vg0417352590 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 17352590
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAAAGATGAATGCTCGAAGGAGAAAAAATTCATTCATTGCTTGCAGCAAGATGGAAATACCCTGCACACACACGAGGACAAAGCAGCTCACCTTCATGCC[C/A]
ACTTCAACTCAATCTTAGGGACAAGAAGACAGCGTGGCTGCACATTAAATTGGGAAGCATTAGGACTGAGTACAATACAAGATGATAGCATGGATGAGCC

Reverse complement sequence

GGCTCATCCATGCTATCATCTTGTATTGTACTCAGTCCTAATGCTTCCCAATTTAATGTGCAGCCACGCTGTCTTCTTGTCCCTAAGATTGAGTTGAAGT[G/T]
GGCATGAAGGTGAGCTGCTTTGTCCTCGTGTGTGTGCAGGGTATTTCCATCTTGCTGCAAGCAATGAATGAATTTTTTCTCCTTCGAGCATTCATCTTTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.70% 6.90% 5.90% 6.50% NA
All Indica  2759 94.20% 1.10% 3.37% 1.30% NA
All Japonica  1512 59.60% 18.80% 6.94% 14.62% NA
Aus  269 62.80% 0.00% 20.82% 16.36% NA
Indica I  595 84.50% 0.20% 11.09% 4.20% NA
Indica II  465 94.20% 4.10% 1.29% 0.43% NA
Indica III  913 98.70% 0.30% 0.55% 0.44% NA
Indica Intermediate  786 96.40% 0.90% 2.04% 0.64% NA
Temperate Japonica  767 61.30% 2.20% 12.13% 24.38% NA
Tropical Japonica  504 52.40% 46.00% 0.99% 0.60% NA
Japonica Intermediate  241 69.30% 14.90% 2.90% 12.86% NA
VI/Aromatic  96 79.20% 0.00% 17.71% 3.12% NA
Intermediate  90 75.60% 12.20% 8.89% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0417352590 C -> DEL LOC_Os04g29270.1 N frameshift_variant Average:27.781; most accessible tissue: Zhenshan97 flag leaf, score: 56.722 N N N N
vg0417352590 C -> A LOC_Os04g29270.1 missense_variant ; p.His887Asn; MODERATE nonsynonymous_codon ; H887N Average:27.781; most accessible tissue: Zhenshan97 flag leaf, score: 56.722 unknown unknown DELETERIOUS 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0417352590 2.65E-16 3.09E-43 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417352590 NA 7.67E-20 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417352590 1.74E-14 1.49E-32 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417352590 NA 6.71E-15 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417352590 NA 6.00E-11 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417352590 3.91E-18 1.98E-48 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417352590 1.40E-06 2.67E-21 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417352590 5.65E-15 3.58E-36 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417352590 NA 1.68E-15 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417352590 8.38E-12 1.29E-24 mr1993_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417352590 8.11E-07 1.34E-15 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251