\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0417244171:

Variant ID: vg0417244171 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 17244171
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATACCAAAGAGAGTCATGTTCTGTTGCAACATCCCAGGATTGACAGTGGGTGAGGAGATCAAGGAGAAATTGTTTGGTTCAGTTGGGGAGACGATCACG[C/T]
CTTAATTGGAATGAGAGACTTCGGGAGTTTTAGTTATTCTATTTGGACACCCAAATGGGCCGATGGTTGTTCTACAGGTGAAAACAATGTCAACGAGGGG

Reverse complement sequence

CCCCTCGTTGACATTGTTTTCACCTGTAGAACAACCATCGGCCCATTTGGGTGTCCAAATAGAATAACTAAAACTCCCGAAGTCTCTCATTCCAATTAAG[G/A]
CGTGATCGTCTCCCCAACTGAACCAAACAATTTCTCCTTGATCTCCTCACCCACTGTCAATCCTGGGATGTTGCAACAGAACATGACTCTCTTTGGTATG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.00% 7.00% 1.33% 2.64% NA
All Indica  2759 97.50% 0.60% 0.91% 0.98% NA
All Japonica  1512 78.80% 19.90% 1.26% 0.07% NA
Aus  269 66.90% 0.00% 1.86% 31.23% NA
Indica I  595 98.50% 0.00% 1.51% 0.00% NA
Indica II  465 96.30% 3.00% 0.43% 0.22% NA
Indica III  913 97.70% 0.20% 0.22% 1.86% NA
Indica Intermediate  786 97.20% 0.10% 1.53% 1.15% NA
Temperate Japonica  767 96.20% 3.00% 0.78% 0.00% NA
Tropical Japonica  504 50.00% 47.60% 2.18% 0.20% NA
Japonica Intermediate  241 83.40% 15.80% 0.83% 0.00% NA
VI/Aromatic  96 71.90% 0.00% 14.58% 13.54% NA
Intermediate  90 84.40% 15.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0417244171 C -> DEL N N silent_mutation Average:38.709; most accessible tissue: Zhenshan97 young leaf, score: 75.751 N N N N
vg0417244171 C -> T LOC_Os04g29080-LOC_Os04g29090 intergenic_region ; MODIFIER silent_mutation Average:38.709; most accessible tissue: Zhenshan97 young leaf, score: 75.751 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0417244171 NA 7.39E-07 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417244171 NA 4.79E-07 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417244171 8.64E-25 7.02E-51 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417244171 4.51E-10 1.21E-27 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417244171 4.39E-27 1.58E-42 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417244171 8.77E-11 5.30E-24 mr1410 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417244171 NA 4.86E-07 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417244171 NA 1.11E-11 mr1864 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417244171 NA 6.86E-07 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417244171 NA 2.28E-10 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417244171 NA 3.50E-10 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417244171 NA 5.36E-08 mr1993 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417244171 4.91E-26 9.78E-55 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417244171 3.77E-11 2.31E-30 mr1301_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417244171 2.42E-27 4.62E-44 mr1410_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417244171 7.20E-12 4.80E-24 mr1410_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417244171 3.84E-14 3.88E-24 mr1993_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417244171 9.28E-08 2.75E-17 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251