Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0417244171:

Variant ID: vg0417244171 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 17244171
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CATACCAAAGAGAGTCATGTTCTGTTGCAACATCCCAGGATTGACAGTGGGTGAGGAGATCAAGGAGAAATTGTTTGGTTCAGTTGGGGAGACGATCACG[C/T]
CTTAATTGGAATGAGAGACTTCGGGAGTTTTAGTTATTCTATTTGGACACCCAAATGGGCCGATGGTTGTTCTACAGGTGAAAACAATGTCAACGAGGGG

Reverse complement sequence

CCCCTCGTTGACATTGTTTTCACCTGTAGAACAACCATCGGCCCATTTGGGTGTCCAAATAGAATAACTAAAACTCCCGAAGTCTCTCATTCCAATTAAG[G/A]
CGTGATCGTCTCCCCAACTGAACCAAACAATTTCTCCTTGATCTCCTCACCCACTGTCAATCCTGGGATGTTGCAACAGAACATGACTCTCTTTGGTATG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.00%	7.00%	1.33%	2.64%	NA
All Indica	2759	97.50%	0.60%	0.91%	0.98%	NA
All Japonica	1512	78.80%	19.90%	1.26%	0.07%	NA
Aus	269	66.90%	0.00%	1.86%	31.23%	NA
Indica I	595	98.50%	0.00%	1.51%	0.00%	NA
Indica II	465	96.30%	3.00%	0.43%	0.22%	NA
Indica III	913	97.70%	0.20%	0.22%	1.86%	NA
Indica Intermediate	786	97.20%	0.10%	1.53%	1.15%	NA
Temperate Japonica	767	96.20%	3.00%	0.78%	0.00%	NA
Tropical Japonica	504	50.00%	47.60%	2.18%	0.20%	NA
Japonica Intermediate	241	83.40%	15.80%	0.83%	0.00%	NA
VI/Aromatic	96	71.90%	0.00%	14.58%	13.54%	NA
Intermediate	90	84.40%	15.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0417244171	C -> DEL	N	N	silent_mutation	Average:38.709; most accessible tissue: Zhenshan97 young leaf, score: 75.751	N	N	N	N
vg0417244171	C -> T	LOC_Os04g29080-LOC_Os04g29090	intergenic_region ; MODIFIER	silent_mutation	Average:38.709; most accessible tissue: Zhenshan97 young leaf, score: 75.751	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0417244171	NA	7.39E-07	mr1248	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417244171	NA	4.79E-07	mr1252	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417244171	8.64E-25	7.02E-51	mr1301	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417244171	4.51E-10	1.21E-27	mr1301	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417244171	4.39E-27	1.58E-42	mr1410	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417244171	8.77E-11	5.30E-24	mr1410	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417244171	NA	4.86E-07	mr1668	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417244171	NA	1.11E-11	mr1864	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417244171	NA	6.86E-07	mr1951	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417244171	NA	2.28E-10	mr1980	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417244171	NA	3.50E-10	mr1993	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417244171	NA	5.36E-08	mr1993	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417244171	4.91E-26	9.78E-55	mr1301_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417244171	3.77E-11	2.31E-30	mr1301_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417244171	2.42E-27	4.62E-44	mr1410_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417244171	7.20E-12	4.80E-24	mr1410_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417244171	3.84E-14	3.88E-24	mr1993_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417244171	9.28E-08	2.75E-17	mr1993_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251