\
| Variant ID: vg0416982091 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 16982091 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 295. )
GGGATTCAATATGTTCAAGGATGATGCGATTTGCCTTGCTCAGAGACAACGGCCTTCCGAACCTTCGGCGACGATCGCGAACCACGCTTCGGGAACCTCC[G/A]
GAACGACAGAAGCTACGCGAAGCACACAAGCAAAGCTACAAGCCTATAAAGAAGCAATAACAATACATAAAAAGAAAGCACAGGGTTCTTTAGGTTATAG
CTATAACCTAAAGAACCCTGTGCTTTCTTTTTATGTATTGTTATTGCTTCTTTATAGGCTTGTAGCTTTGCTTGTGTGCTTCGCGTAGCTTCTGTCGTTC[C/T]
GGAGGTTCCCGAAGCGTGGTTCGCGATCGTCGCCGAAGGTTCGGAAGGCCGTTGTCTCTGAGCAAGGCAAATCGCATCATCCTTGAACATATTGAATCCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.70% | 1.30% | 1.97% | 0.00% | NA |
| All Indica | 2759 | 96.90% | 1.30% | 1.78% | 0.00% | NA |
| All Japonica | 1512 | 97.00% | 1.10% | 1.92% | 0.00% | NA |
| Aus | 269 | 91.40% | 3.30% | 5.20% | 0.00% | NA |
| Indica I | 595 | 87.60% | 5.00% | 7.39% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.10% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 99.00% | 0.60% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 95.30% | 1.60% | 3.13% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.30% | 1.70% | 2.07% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 0.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0416982091 | G -> A | LOC_Os04g28670.1 | upstream_gene_variant ; 931.0bp to feature; MODIFIER | silent_mutation | Average:29.126; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 | N | N | N | N |
| vg0416982091 | G -> A | LOC_Os04g28680.1 | upstream_gene_variant ; 4079.0bp to feature; MODIFIER | silent_mutation | Average:29.126; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 | N | N | N | N |
| vg0416982091 | G -> A | LOC_Os04g28650.1 | downstream_gene_variant ; 4496.0bp to feature; MODIFIER | silent_mutation | Average:29.126; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 | N | N | N | N |
| vg0416982091 | G -> A | LOC_Os04g28660.1 | downstream_gene_variant ; 1665.0bp to feature; MODIFIER | silent_mutation | Average:29.126; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 | N | N | N | N |
| vg0416982091 | G -> A | LOC_Os04g28660-LOC_Os04g28670 | intergenic_region ; MODIFIER | silent_mutation | Average:29.126; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0416982091 | 2.01E-06 | 2.01E-06 | mr1987 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |