Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0416978994:

Variant ID: vg0416978994 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 16978994
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAACTACACAAATACTCATTGGTGCCGGTTCCAAAGGTCTCATAGGCCGTCGGCCGCCGCCTCGCGTTCTACCACCCCACTGGCTGCCACCTCGCCGGGC[G/A]
CCACCTTGCCGGCTGCCACCTCACCTTCTGTCACCCTACCAATCACCAAAATCTTAGAAAACAAAATCCAAATCAAACCAAAAGGGGATGAAGAGGTAGA

Reverse complement sequence

TCTACCTCTTCATCCCCTTTTGGTTTGATTTGGATTTTGTTTTCTAAGATTTTGGTGATTGGTAGGGTGACAGAAGGTGAGGTGGCAGCCGGCAAGGTGG[C/T]
GCCCGGCGAGGTGGCAGCCAGTGGGGTGGTAGAACGCGAGGCGGCGGCCGACGGCCTATGAGACCTTTGGAACCGGCACCAATGAGTATTTGTGTAGTTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.00% 1.10% 0.91% 0.00% NA
All Indica  2759 96.70% 1.80% 1.49% 0.00% NA
All Japonica  1512 99.90% 0.00% 0.07% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 88.60% 7.40% 4.03% 0.00% NA
Indica II  465 99.40% 0.00% 0.65% 0.00% NA
Indica III  913 99.90% 0.00% 0.11% 0.00% NA
Indica Intermediate  786 97.60% 0.80% 1.65% 0.00% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0416978994 G -> A LOC_Os04g28660.1 upstream_gene_variant ; 859.0bp to feature; MODIFIER silent_mutation Average:53.449; most accessible tissue: Zhenshan97 young leaf, score: 85.184 N N N N
vg0416978994 G -> A LOC_Os04g28670.1 upstream_gene_variant ; 4028.0bp to feature; MODIFIER silent_mutation Average:53.449; most accessible tissue: Zhenshan97 young leaf, score: 85.184 N N N N
vg0416978994 G -> A LOC_Os04g28650.1 downstream_gene_variant ; 1399.0bp to feature; MODIFIER silent_mutation Average:53.449; most accessible tissue: Zhenshan97 young leaf, score: 85.184 N N N N
vg0416978994 G -> A LOC_Os04g28650-LOC_Os04g28660 intergenic_region ; MODIFIER silent_mutation Average:53.449; most accessible tissue: Zhenshan97 young leaf, score: 85.184 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0416978994 7.04E-06 7.04E-06 mr1275 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416978994 1.17E-06 1.17E-06 mr1736 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416978994 NA 4.28E-07 mr1931_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251