Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0416930919:

Variant ID: vg0416930919 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 16930919
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATATTTAGGGACGGAGGGAGTAGTTCGGAAGAAAACTTCAGTTCCCCTCCATAGGGTACTCTTTCGGCTCATTTCTTCAGAAAAAAAATATTTAAATCT[G/A]
CAATTTTTATGTTGAAATATTTAAACGATTTATGGAGTATAAAATCCTCGTCCCACCACTATACAATCCGTTCCCCTATCACTCACCTCTGTAACCCTTA

Reverse complement sequence

TAAGGGTTACAGAGGTGAGTGATAGGGGAACGGATTGTATAGTGGTGGGACGAGGATTTTATACTCCATAAATCGTTTAAATATTTCAACATAAAAATTG[C/T]
AGATTTAAATATTTTTTTTCTGAAGAAATGAGCCGAAAGAGTACCCTATGGAGGGGAACTGAAGTTTTCTTCCGAACTACTCCCTCCGTCCCTAAATATT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.40%	1.20%	1.21%	0.23%	NA
All Indica	2759	98.80%	0.80%	0.40%	0.00%	NA
All Japonica	1512	95.20%	2.20%	2.58%	0.00%	NA
Aus	269	94.40%	0.00%	1.49%	4.09%	NA
Indica I	595	98.30%	0.50%	1.18%	0.00%	NA
Indica II	465	97.20%	2.80%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	98.70%	0.80%	0.51%	0.00%	NA
Temperate Japonica	767	90.90%	4.30%	4.82%	0.00%	NA
Tropical Japonica	504	99.60%	0.20%	0.20%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	95.60%	1.10%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0416930919	G -> DEL	N	N	silent_mutation	Average:48.603; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0416930919	G -> A	LOC_Os04g28590.1	upstream_gene_variant ; 2167.0bp to feature; MODIFIER	silent_mutation	Average:48.603; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0416930919	G -> A	LOC_Os04g28600.1	upstream_gene_variant ; 614.0bp to feature; MODIFIER	silent_mutation	Average:48.603; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0416930919	G -> A	LOC_Os04g28590-LOC_Os04g28600	intergenic_region ; MODIFIER	silent_mutation	Average:48.603; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0416930919	9.10E-06	9.10E-06	mr1245_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416930919	3.39E-07	3.39E-07	mr1360_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416930919	9.11E-06	9.11E-06	mr1371_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416930919	9.32E-07	9.32E-07	mr1445_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416930919	8.82E-07	8.82E-07	mr1645_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416930919	3.23E-07	3.23E-07	mr1647_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416930919	3.98E-06	3.98E-06	mr1655_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416930919	3.12E-07	3.12E-07	mr1657_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251