\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0416930919:

Variant ID: vg0416930919 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 16930919
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATATTTAGGGACGGAGGGAGTAGTTCGGAAGAAAACTTCAGTTCCCCTCCATAGGGTACTCTTTCGGCTCATTTCTTCAGAAAAAAAATATTTAAATCT[G/A]
CAATTTTTATGTTGAAATATTTAAACGATTTATGGAGTATAAAATCCTCGTCCCACCACTATACAATCCGTTCCCCTATCACTCACCTCTGTAACCCTTA

Reverse complement sequence

TAAGGGTTACAGAGGTGAGTGATAGGGGAACGGATTGTATAGTGGTGGGACGAGGATTTTATACTCCATAAATCGTTTAAATATTTCAACATAAAAATTG[C/T]
AGATTTAAATATTTTTTTTCTGAAGAAATGAGCCGAAAGAGTACCCTATGGAGGGGAACTGAAGTTTTCTTCCGAACTACTCCCTCCGTCCCTAAATATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.40% 1.20% 1.21% 0.23% NA
All Indica  2759 98.80% 0.80% 0.40% 0.00% NA
All Japonica  1512 95.20% 2.20% 2.58% 0.00% NA
Aus  269 94.40% 0.00% 1.49% 4.09% NA
Indica I  595 98.30% 0.50% 1.18% 0.00% NA
Indica II  465 97.20% 2.80% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 98.70% 0.80% 0.51% 0.00% NA
Temperate Japonica  767 90.90% 4.30% 4.82% 0.00% NA
Tropical Japonica  504 99.60% 0.20% 0.20% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 1.10% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0416930919 G -> DEL N N silent_mutation Average:48.603; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0416930919 G -> A LOC_Os04g28590.1 upstream_gene_variant ; 2167.0bp to feature; MODIFIER silent_mutation Average:48.603; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0416930919 G -> A LOC_Os04g28600.1 upstream_gene_variant ; 614.0bp to feature; MODIFIER silent_mutation Average:48.603; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0416930919 G -> A LOC_Os04g28590-LOC_Os04g28600 intergenic_region ; MODIFIER silent_mutation Average:48.603; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0416930919 9.10E-06 9.10E-06 mr1245_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416930919 3.39E-07 3.39E-07 mr1360_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416930919 9.11E-06 9.11E-06 mr1371_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416930919 9.32E-07 9.32E-07 mr1445_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416930919 8.82E-07 8.82E-07 mr1645_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416930919 3.23E-07 3.23E-07 mr1647_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416930919 3.98E-06 3.98E-06 mr1655_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416930919 3.12E-07 3.12E-07 mr1657_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251